ELSEVIER
Contents lists available at ScienceDirect
Journal of Steroid Biochemistry and Molecular Biology
journal homepage: www.elsevier.com/locate/jsbmb
-
The Journal of Steroid Biochemistry & Molecular Biology
Androgen production in adrenocortical H295R cells is regulated by thyroid hormone T3 without reciprocal thyroid axis modulation in pediatric CAH
Check for updates
Philipp Augsburger a,b,c, Therina du Toit b,d, Emre Murat Altinkiliç a,b,e, Sabine Hannema f,i, Christiaan de Bruin , Evangelia Charmandari &,h, Erica L.T. van den Akker 1, Christa E. Flück a,b,*,1
a Department of Pediatric Endocrinology, Diabetology, and Metabolism, Inselspital, Bern University Hospital, Bern 3010, Switzerland
b Department of BioMedical Research (DBMR), University of Bern, Bern 3008, Switzerland
” Graduate School for Cellular and Biomedical Sciences, University of Bern, Bern 3008, Switzerland
d Department of Nephrology and Hypertension, Bern University Hospital, Bern 3010, Switzerland
e Department of Medical Biology, Faculty of Medicine, Yeditepe University, İonönü Mahallesi, 44755 Ataşehir, Istanbul, Türkiye
Division of Pediatric Endocrinology, Department of Pediatrics, Willem-Alexander Children’s Hospital, Leiden University Medical Centre, Leiden 2333 ZA, the Netherlands
8 Division of Endocrinology, Metabolism and Diabetes, First Department of Pediatrics, National and Kapodistrian University of Athens Medical School, ‘Aghia Sophia’
Children’s Hospital, Athens 11527, Greece
h Division of Endocrinology and Metabolism, Center of Clinical, Experimental Surgery and Translational Research, Biomedical Research Foundation of the Academy of Athens, Athens 11527, Greece
Division of Pediatric Endocrinology, Department of Pediatrics, Erasmus University Medical Centre, Sophia Children’s Hospital, Rotterdam 3015 GD, the Netherlands
ARTICLE INFO
Dataset link: Trancriptome Profiling and Pathway Analysis in H295R cells upon T3 treatment
Keywords: Adrenal cortex Androgens Dehydroepiandrosterone (DHEA) Thyroid hormone Hypothalamic-Pituitary-Thyroid (HPT) axis Congenital Adrenal Hyperplasia (CAH) H295R cells
ABSTRACT
Thyroid hormones (THs) are critical regulators of human development, cellular differentiation, and metabolism. While their systemic effects are well established, their role in adrenal androgen production remains poorly defined. Moreover, potential feedback regulation of the hypothalamic-pituitary-thyroid (HPT) axis by adrenal androgens has not been thoroughly investigated. This study aimed to clarify the regulatory effects of THs on adrenal androgens and to investigate potential feedback mechanisms in patients with congenital adrenal hy- perplasia (CAH). In an in-vitro experiment, treatment with 3,3’,5-triiodo-L-thyronine (T3) on adrenocortical carcinoma H295R cells significantly reduced dehydroepiandrosterone (DHEA) and DHEA-sulfate production while modestly increasing testosterone (T) and androstenedione (A4). These changes were associated with an increase in expression of HSD3B2 and AKR1C3, and a decrease of CYP17A1. Transcriptomic analysis additionally revealed enrichment of pathways related to steroidogenesis and adrenal development through T3 treatment. In the clinical part of the study, hormone levels in pediatric CAH patients were analyzed. Serum free thyroxine (fT4) and thyroid-stimulating hormone (TSH) showed weak negative correlations with the adrenal androgens DHEA and A4. However, no differences in fT4 or TSH concentrations were observed between well-controlled and hyperandrogenic patients, suggesting a lack of feedback regulation by adrenal androgens on the HPT axis. In conclusion, these findings suggest that THs regulate adrenal androgen production by modulating the activity of key steroidogenic enzymes. This relationship appears to be predominantly unidirectional, with THs influencing adrenal steroidogenesis but adrenal androgens not altering HPT axis function.
* Correspondence to: Pediatric Endocrinology, Diabetology and Metabolism, University Children’s Hospital Bern, Freiburgstrasse 65 / C845, Bern 3010, Switzerland.
E-mail addresses: philipp.augsburger@students.unibe.ch (P. Augsburger), therina.dutoit@unibe.ch (T. du Toit), emremurat.altinkilic@yeditepe.edu.tr (E.M. Altinkiliç), s.e.hannema@amsterdamumc.nl (S. Hannema), c.de_bruin@lumc.nl (C. de Bruin), evangelia.charmandari@googlemail.com (E. Charmandari), e. l.t.vandenakker@erasmusmc.nl (E.L.T. van den Akker), christa.flueck@unibe.ch (C.E. Flück).
1 ORCID: 0000-0002-4568-5504.
https://doi.org/10.1016/j.jsbmb.2026.106939
1. Introduction
The human adrenal cortex consists of distinct zones, each highly specialized for steroid hormone production. Across development, from fetal through postnatal and adult life, the adrenal cortex undergoes profound structural and functional transformations, many of which remain incompletely understood. Prenatally, the fully formed fetal cortex is organized into three zones, of which the inner fetal zone (FZ) produces primarily the androgen precursor dehydroepiandrosterone (DHEA) and its sulfate DHEAS. After birth, the FZ involutes, giving rise to the postnatal adrenal cortex, which initially comprises two functional layers, i.e. the outermost zona Glomerulosa (zG) for mineralocorticoid (MC) production and the adjacent zona Fasciculata (zF) for glucocorti- coid (GC) production. In contrast to the zG and zF, the zona Reticularis (zR), the innermost cortical layer, develops gradually over the first years of life [1]. Its production of adrenal (precursor) androgens becomes clinically evident around 6-8 years of age, marking the onset of adrenarche.
Androgen production of the zR relies on the activity of steroidogenic acute regulatory protein (StAR), which transports cholesterol into mitochondria, where it is converted into pregnenolone (P5) by the rate- limiting cytochrome P450 side chain cleavage (CYP11A1)/ferredoxin reductase (FDXR)/ferredoxin (FDX) enzyme system. This is followed by the high activity of 17x-hydroxylase/17,20-lyase of cytochrome P450 17A1 (CYP17A1) enhanced by its cofactors cytochrome b5 (CYB5) and cytochrome P450 oxidoreductase (POR); by contrast, the activity of 3ß- hydroxysteroid dehydrogenase type 2 (HSD3B2) in the zR is low [2-4]. The distinct gene expression profile and enzymatic activities of the zR direct its steroid flux along the 45 pathway, converting P5 to 17a-hydroxypregnenolone (17OHP5) and DHEA, the primary androgen precursor synthesized by the adrenal cortex [5]. Further metabolism involves sulfotransferase 2A1 (SULT2A1) and its sulfate donor 3’-phos- phoadenosine 5’-phosphosulfate synthase 2 (PAPSS2); it facilitates the conversion of DHEA to its sulfated derivative DHEAS [6], which is the most abundant adrenal androgen metabolite in circulation [7,8]. Addi- tionally, a notable fraction of DHEA is converted to androstenedione (A4) by HSD3B2, while cytochrome P450 11B1 (CYP11B1) mediates hydroxylation of A4 to 11ß-hydroxyandrostenedione [9]. A4 can also be converted to testosterone (T) by 17ß-hydroxysteroid dehydrogenase type 5 (HSD17B5), also known as aldo-keto reductase family 1 member C3 (AKR1C3), and then further metabolized to dihydrotestosterone (DHT) by steroid-5x-reductase (SRD5A) [9].
While basic studies have significantly advanced our understanding of adrenal cortex structure and function, the regulatory mechanisms gov- erning its development - particularly those related to the zR - and function, remain largely unresolved. Accumulating evidence suggests that thyroid hormones (THs), i.e. 3,3’,5,5’-tetraiodo-L-thyronine (T4) and its biologically active derivative 3,3’,5-triiodo-L-thyronine (T3), may contribute to the regulation of zR development, zonation and function [10-17]. TH secretion is stimulated by thyroid-stimulating hormone (TSH) from the anterior pituitary, which in turn is regulated by thyrotropin-releasing hormone (TRH) from the hypothalamus, forming the hypothalamic pituitary thyroid (HPT) axis [18]. The thyroid gland primarily secretes T4 [19], which is largely converted to T3 in peripheral tissues by type I and II deiodinases (DIO1, DIO2) [20]. T4 and T3 exert their effects by binding to and activating specific ligand-dependent nuclear receptors (TR&1, TRß1 and TRß2), encoded by the thyroid hormone receptor alpha (THRA) and beta (THRB) genes [21, 22]. These receptors typically form heterodimers with the retinoid X receptor (RXR) or retinoic acid receptor (RAR) and, upon activation, bind to thyroid response elements (TREs) in gene promoters, thereby regulating transcription [22-25].
Previous studies have suggested a possible role of THs in adrenal cortex formation [10,12,15]. Early work reported an association be- tween excess circulating THs and adrenocortical hypertrophy in several species, including mouse, rat, rabbit, cat and guinea pig [10], reviewed
in [26]. In contrast, the inner adrenal cortex X-zone was found to be poorly developed in hypothyroid mice [12]. More recent studies demonstrated that mice express TRß1 in inner adrenal cortical cells, and that TRß1-deficient mice are resistant to T3-mediated cortical hyper- trophy [15]. In addition, both hypothyroid and hyperthyroid mice exhibited significant alterations in adrenal gene expression profiles compared to controls [17]. In hyperthyroid mice, genes involved in cholesterol synthesis were upregulated together with thyroid hormone receptor beta (Thrb), whereas Wnt family member 4 (Wnt4) transcripts were decreased. In hypothyroid mice, Star and Cyp11a1 were down- regulated. Likewise, in another study, male and female mice treated with T3 showed upregulation of genes involved in cholesterol biosyn- thesis and Thrb, while Star and Cyp11a1 were only mildly affected [16]. For other genes, differential expression was highly sex dependent: Cyp11b1 and Hsd3b1 were most significantly downregulated in T3-treated females, whereas Wnt4 expression was most notably down- regulated in males. Consistent with findings in mice, thyroidectomized rats presented with reduced adrenal CYP11A1 activity [11]. These findings prompted others to hypothesize that low circulating concen- trations of T4 and T3 may diminish CYP11A1 activity and thereby inhibit adrenal androgen production in hypothyroid humans [27-29].
However, although mice studies are valuable for investigating mechanisms of TH action in adrenals in vivo, they do not permit final conclusions regarding human adrenocortical physiology due to signifi- cant species-specific differences in adrenal zonation and function. Notably, adult mice do not form a distinct zR and lack Cyp17a1 expression, rendering them incapable of synthesizing androgens in the adrenal cortex [30]. Consequently, studies based on human cell models are essential to examine the role of THs in adrenal zonation and androgen production in humans [31]. In previous studies using human cells isolated from androgen-producing fetal adrenals, treatment with T3 or T4 together with adrenocorticotropic hormone (ACTH) increased HSD3B2 activity, whereas SULT2A1 activity remained unchanged [13]. In human adrenocortical carcinoma H295A cells, T3 was shown to in- crease POR expression [14]. However, whether T3 directly alters CYP17A1 activity has not yet been investigated, although it has been proposed to do so in promoting DHEA synthesis [31].
Evidence for this hypothesis comes from studies in osteoblasts [32] and mesenchymal stem cells [33], where T3 activates p38, a kinase known to stimulate adrenal CYP17A1 activity [34]. However, the po- tential effects of T3 on other androgen-producing enzymes, such as AKR1C3 or CYP11B1, remain unknown. Taken together, studies using cell models are currently insufficient to establish a definitive role for THs in human adrenal cortex regulation. Likewise, only a limited number of studies suggest an association between THs and adrenal androgens across various health conditions (Suppl. Table 1). Most of these studies have focused on adults with impaired thyroid function, whereas the role of THs in adrenal androgen production during childhood remains poorly studied. In turn, studies assessing the potential role of zR androgens in regulating THs and the HPT axis are scarce. To date, only two studies have reported correlations between TH concentrations and adrenal an- drogens in children with premature adrenarche (PA) [17,35]. Other hyperandrogenic conditions, such as congenital adrenal hyperplasia (CAH), have yet to be examined.
Therefore, to investigate the regulatory role of THs in adrenal androgen production, human adrenocortical carcinoma H295R cells were treated with T3, and alterations in the steroid and transcript pro- files were analyzed. To further explore potential interactions between hyperandrogenism and TH regulation, we also examined correlations between serum free T4 (fT4) and TSH concentrations with various ad- renal androgens in patients with CAH. By comparing these correlations in well-controlled versus hyperandrogenic CAH patients, we addressed the question of whether adrenal androgens might exert a regulatory feedback effect on the HPT axis.
2. Materials and methods
2.1. Cell experiments
2.1.1. Cell culture conditions
Human adrenocortical carcinoma NCI-H295R cells (ATCC, Mana- ssas, VA) were cultured as a monolayer in normal growth media (NGM) composed of Dulbecco’s modified Eagle’s medium/ Ham’s F-12 medium containing 2.5 mM L-glutamine and 15 mM HEPES medium (Thermo Fisher Scientifc, 113300) supplemented with 5% NU-I serum (Corning®, Corning, NY), 0.1% insulin, transferrin, and selenium (ITS) (Corning®, Corning, NY), 1% penicillin and streptomycin (Thermo Fisher Scientifc, 15140122) at 37°C and 5% CO2. Serum starvation medium (SM) con- tained the same components as NGM except NU-I serum and ITS.
3,3,5-triiodo-L-thyronine sodium salt (Sigma-Aldrich, T6397) was dissolved in sterile 1 M NaOH to generate a 1 µM stock solution, which was diluted with SM to achieve a final concentration of 1 nM. SM for control wells contained the same amount of NaOH as the treatment media.
Cells were divided into multi-well plates (Sarstedt, Nümbrecht, Germany; transcriptome profiling: 12 well plates, density 0.35 x105 cells/well, 2 triplicates and 1 duplicate; steroid profiling experiment: 6 well plates, density 1 ×106 cells/well, 2 triplicates and 1 duplicate) and incubated for 24 h in SM, before the media was replaced with T3- enriched SM. For transcriptome profiling, cells were harvested 48 h after T3-treatment and processed for RNA-extraction (see 2.1.2). For steroid profiling, T3-enriched SM was replaced with fresh equivalent media 18 h after the beginning of the T3-treatment. Cells and media were collected after an additional 54 h incubation and were used for steroid profiling and protein concentration measurement (see 2.1.3 and 2.1.4).
2.1.2. Total RNA extraction and transcriptome profiling
Total RNA was purified from cells with TRIzol reagent (Sigma, T9424) and Direct-zol RNA kit (Zymo Research, Irvine, CA;) according to the manufacturer’s protocol. For experimental control and validation before RNAseq, we analyzed all samples for HSD3B2 expression by RT- qPCR in-house using the QuantStudio 1 thermocycler (Life Technologies) and the PowerUp™M SYBRTM Green Master Mix (Thermo Fisher Scientific, A25780) according to manufacturer’s instructions. For that, RNA was reverse transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, 4368814). GAPDH tran- scripts were used for internal control and data were analyzed using the 2-ddCt method. We checked for HSD3B2 transcripts with the following primers: Forward: CCACACCGCCTGTATCATTG, Reverse: ACA- CAGGCCTCCAACAGTAG. GAPDH primers were: Forward: GCTCTCTGCTCCTCCTGTTC; Reverse: CGACCAAATCCGTTGACTCC. The result is shown in Suppl. Figure 1. Samples were then sent to Novogene (Cambridge, UK) for quality control and mRNA-seq analysis; cDNA library preparation, and sequencing were performed using an Illumina NovaSeq X Plus sequencer on the PE150 platform.
2.1.3. Steroid profiling
Steroids were quantified by liquid chromatography-high resolution mass spectrometry (LC-MS), using an in-house developed method pre- viously described and validated [36]. In short, 1000 uL of the collected cell supernatants were spiked with a mixture of internal standards, fol- lowed by solid-phase extraction on an OasisPrime HLB 96-well plate (Waters Corporation, Milford, USA). After resuspension in 100 uL 33% methanol in water, 20 uL were injected into the LC-MS instrument (Vanquish UHPLC coupled to a QExactive Orbitrap Plus, Thermo Fisher Scientific) using an Acquity UPLC HSS T3 column (Waters Corporation, Milford, USA). All Data were processed using TraceFinder 4.0 (Thermo Fisher). For each sample, steroid concentrations were normalized by the corresponding protein amounts (see 2.1.4).
2.1.4. Protein amount measurement
Cells were resuspended in PBS, centrifuged and lysed with lysis buffer. Protein amounts were measured according to the manufacturer’s instructions of a detergent compatible protein assay kit (Bio-Rad, Her- cules, CA).
2.1.5. Computational analysis of promoter sequences
Promoter sequence analysis was performed using FIMO within the MEME Suite 5.5.9 Webtool (https://meme-suite.org/meme/tools/fim o), in combination with three different THRB binding motifs (Motif- IDs: MA1574.1, MA1575.1 and MA1576.1) provided by JASPAR (http s://jaspar2022.genereg.net/). Selected gene promoters were searched up to 5 kb upstream of the transcriptional start site. A cut off p-value and q-value of 0.05 were applied to indicate statistical significance and to control for false positive detection. Conservation analysis was conducted using the UCSC Genome Browser website (https://genome.ucsc.edu/), employing a comprehensive multiple sequence alignment across 100 vertebrate genomes.
2.1.6. Statistics
Differential expression analysis for mRNA-seq data was performed via DESeq2 on Novogene’s NovoMagic platform (NovoMagic: Online RNA-seq Bioinformatics Analysis Tool - Novogene), using human reference genome [GRCh38/hg38]), together with gene ontology enrichment analysis. Statistical differences in steroid profile were analyzed via two tailed Student’s t test using GraphPad Prism 8 (GraphPad ware Inc., San Diego, CA). A p-value below 0.05 was used to indicate statistical significance. Details of statistical analyses are given in the figure legends.
2.2. Study on biomaterial samples from pediatric CAH individuals
2.2.1. Ethics and informed consent
Samples for analysis were available from a previous prospective, observational multi-center study [37,38], between “Aghia Sophia” Children’s Hospital, National and Kapodistrian University of Athens Medical School (Athens, Greece); University Hospital Inselspital (Bern, Switzerland); Sophia Children’s Hospital, Erasmus Medical Center (Rotterdam, The Netherlands); and Willem-Alexander Children’s Hos- pital, Leiden University Medical Centre (Leiden, The Netherlands). The study was carried out according to the Declaration of Helsinki and approved by the medical ethics committees of the four hospitals. All parents/guardians and children ≥ 12 years provided written informed consent, and children aged < 12 years gave their oral assent.
2.2.2. Study design
For this specific research question, children and adolescents aged 0-18 years with CAH due to genetically confirmed 21-hydroxylase deficiency (21OHD) involving the CYP21A2 gene were included. Par- ticipants were excluded if they 1) had intercurrent illnesses at the time of the visit or within the preceding week, or 2) were unable to adequately comprehend the written study information due to limited language proficiency.
2.2.3. Clinical and biochemical assessments
All participants underwent a detailed, standardized clinical and biochemical evaluation during two consecutive follow-up visits, with a mean interval of 4.1 ± 0.7 months. Metabolic control of CAH patients was categorized as either well-controlled, undertreated (i.e., hyper- androgenic) or over-treated by experienced pediatric endocrinologists, in accordance with current clinical guidelines [39] and as reported herein [37,38]. The study parameters have been described in detail in recent publications [37,38] and are summarized in Suppl. Table 2 as relevant to this analysis, together with serum androgen concentrations between well- and undertreated patients. Notably, steroid measure- ments were centralized and performed in Bern using the same LC-MS
protocol applied for cell culture analyses (2.1.3). In contrast, fT4 and TSH concentrations were measured locally at each of the four partici- pating centers using different immunoassay platforms, and values were assessed by the normative ranges from each center (Suppl. Table 3). Visits were excluded from the analysis, if TSH or fT4 were outside the reference range in order to omit patients with concomitant thyroid disorders.
2.2.4. Statistics
Statistical analyses were performed using the IBM SPSS statistics software, Version 29.0.2.0 (IBM Corp., Armonk, NY, USA). A p-value less than 0.05 was used to indicate statistical significance. The distri- bution of fT4 and TSH values was assessed for each center separately by the Shapiro-Wilk and Kolmogorov-Smirnov tests, and by visual inspec- tion of histograms and QQ plots. fT4 and TSH values from each center were then transformed by a rank-based normalization. Linear regression analyses were adjusted for sex, age, BMI-z-score, pubertal status, CAH subtype and treatment quality.
3. Results
3.1. Triiodothyronine alters steroid and gene expression profiles in H295R cells
To investigate the regulatory role of T3 in adrenal androgen pro- duction, we cultured adrenal H295R cells in serum-free media supple- mented with T3. Steroid profiling of the cell supernatants by LC-MS revealed that T3 significantly downregulated DHEA (-35 %) and DHEAS (-42%) production, while modestly increasing T (+20 %) and A4 (+9 %) synthesis. Production of 11OHA4 also increased (+24%), although this did not reach statistical significance (p = 0.079), likely due to limited sample size and small effect size. DHT levels remained unchanged (Fig. 1A). In addition, a parallel increase in cortisol (+62%) and
aldosterone production (+68 %) was also observed (Suppl Table 4).
To explore whether altered enzymatic activity underlies the T3- mediated shift in androgen production, we calculated specific sub- strate to product ratios. Elevated P4/P5 (+153 %), 17OHP4/17OHP5 (+96 %) and A4/DHEA ratios (+92 %) indicated increased HSD3B2 activity. Likewise, increased T/A4 (+28 %) and 11OHA4/A4 ratios (+31 %) suggested upregulation of AKR1C3 and CYP11B1 and/or CYP11B2, respectively. Conversely, reduced 17OHP4/P4 (-33 %) and DHEA/17OHP5 ratios (-23 %) pointed to decreased CYP17A1 activity, although A4/17OHP4 and 17OHP5/P5 ratios did not change signifi- cantly. Activities of SULT2A1 and SRD5A1 appeared unaffected, as indicated by unchanged DHEAS/DHEA and DHT/T ratios, respectively (Fig. 1B). Likewise, the total sums of all measured steroids did not differ between control and treatment groups, indicating that T3 did not up- or downregulate overall steroidogenesis but rather shifted fluxes through the different pathways. All fold-changes calculations for steroids and androgen ratios are summarized in Suppl. Table 4.
Next, we performed transcriptome profiling of T3-treated versus untreated H295R cells to elucidate the molecular mechanisms under- lying the observed alterations in androgen production. Differential gene expression analysis, using an adjusted p-value cutoff of 0.05, identified 476 differentially expressed genes, with 278 upregulated and 198 downregulated following T3 treatment. Consistent with the steroid profile, T3 treatment led to increased expression of HSD3B2 and AKR1C3, while CYP17A1 transcripts were significantly reduced (Fig. 2A). Among other genes involved in androgen biosynthesis, CYP11A1, SULT2A1, and PAPSS2 were slightly downregulated. Expression levels of STAR, CYP11B1, CYP11B2, SRD5A1, POR and CYB5A, as well as of DIO1 and DIO2 remained unchanged (Suppl. Figure 2).
Gene set enrichment analysis of the gene ontology terms associated with all differentially expressed genes revealed several pathways linked to steroidogenesis and developmental biology that were modulated by
A
B
Metabolites
Steroid Ratios
3
*
1.5
ns
.
*
*
*
ns
U
.
*
fold change
1.0
.
fold change
2
**
U
*
+
**
0.5
ns
.T.
ns
ns
ns
”
1
**
*
T
4
A
0.0
.
DHEA
DHEAS
1
A4
DHT
11OHA4
0
P4/P5
A4/DHEA
17OHP4/17OHP5
17OHP4/P4
DHEA/17OHP5
A4/17OHP4
17OHP5/P5
T/A4
11OHA4/A4
DHEAS/DHEA
DHT/T
HSD3B2
CYP17A1
AKR1C3
SULT2A1
SRD5A1
CYP11B1/B2
A
B
Gene Number
☒ 22
male sex differentiation
☒
☒ 14
5
200
qValue
androgen metabolic process
0.05
-log10(padj)
development of primary sexual characteristics
☒
0.04
UP 278
DOWN 198
100
response to steroid hormone
☒
0.03
cellular response to steroid hormone stimulus
☒
0.02
CYP11A1
AKR1C3
SULT2A1
CYP17A1
sex differentiation
☒
PAPSS2
HSD3B2
1.301
steroid metabolic process
☒
-2
0
2
4
log2FoldChange
0
0.02
0.04
0.06
gene ratio
C
DUSP6
Edge Confidence
SHH
WNT4
☐ ☐ low (0.15)
NKD1
☐ ☐ medium (0.40)
high (0.70)
highest (0.90)
CTNNB1
INHA
AMHR2
MC2R
CYP11A1
CYP11B2
CYP19A1
CYP1741
STAR
AKR1C2
SRD5A1
CYP11B1
HSD3B2
AKRIC8
CYB5A
POR
SULT2A1
PAPSS2
CYP3A5
GSTA2
GSTA1
T3 (Fig. 2B; Suppl. Table 5). Notably, gene sets linked to ‘androgen metabolic pathway’, ‘(male) sex differentiation’ and ‘development of primary sexual characteristics’ included upregulated WNT4, and/or downregulated CTNNB1 and SHH, which are known regulators of zG function and adrenal zonation [40,41]. Furthermore, we identified important players for gonadal function and development, including upregulated INHA and downregulated AMHR2 and CYP19A1. Pathways such as ‘(cellular) response to steroid hormone (stimulus)’ and ‘steroid metabolic process’ featured upregulation of IGFBP7, MGARP, AKR1C2 and/or CYP3A5.
Next, to further explore the interplay among the T3-regulated genes involved in adrenal androgen biosynthesis, we conducted a STRING protein-protein interaction analysis. We included all differentially expressed genes, as well as non-differentially expressed genes essential for androgen biosynthesis (Fig. 2C). In addition to the previously described factors, the analysis identified strongly upregulated GSTA1 and GSTA2, as well as upregulated DUSP6 and downregulated ACTH-
receptor MC2R. Furthermore, we observed that THRB was highly upregulated. This seems to be the main mediator of the T3-induced ef- fects, as THRA was not differentially expressed (Suppl. Figure 2). To further explore whether T3-stimulated THRB might directly regulate gene expression of differentially expressed genes, we searched for TREs in their promoter regions. This analysis revealed potential THRB DNA- binding sites in the promoters of PAPSS2, SHH, THRB, MGARP and AMHR2 (Suppl. Table 6). However, only a low degree of sequence similarity/identity across vertebrates was observed.
The differential expression of all genes of interest is summarized in Suppl. Table 7, together with their known zonal expression patterns in the adrenal cortex. Full gene names of all mentioned genes are provided in Suppl. Table 8.
3.2. Thyroid hormones and adrenal androgens in children with CAH
To investigate the interrelationship between THs and zR-derived
androgens, we analyzed serum samples from euthyroid children with CAH due to 21-hydroxylase deficiency, a hyperandrogenic disorder, collected as part of a prospective multicenter study [37,38]. Of 169 visits from 86 CAH patients, biosamples were available for thyroid hormone analysis from 83 visits involving 70 patients (Suppl. Figure 3). The clinical characteristics of these participants are summarized in Suppl. Table 9.
We first assessed the correlation between fT4 and TSH and circu- lating androgens; unfortunately, T3 measurements were not available for the analysis. Multivariate linear regression analyses, adjusted for sex, age, BMI z-score, pubertal status, CAH subtype and treatment quality, revealed significant correlations between THs and androgens measured from plasma. Specifically, fT4 showed negative correlation with DHEA, androsterone and A4, while TSH negatively correlated with DHEA, androsterone and DHT, respectively (Table 1). No significant associa- tions were found for DHEAS, T, 11OHA4, 11-ketoandrostenedione (11KA4), 11ß-hydroxytestosterone (11OHT) and 11-ketotestosterone (11KT). Furthermore, we found no correlations between THs and an- drogens measured from urine. Partial residual plots illustrating all sta- tistically significant correlations are presented in Fig. 3.
Next, we investigated whether androgens may exert a differential effect on serum TH concentrations in patients with CAH. Hence, we compared fT4 and TSH ranks between hyperandrogenic, undertreated patients and well-controlled, quasi normal-androgenic patients. This analysis revealed no significant difference in serum fT4 and TSH con- centrations between CAH patients with good metabolic control and those with androgen excess due to undertreatment (Fig. 4). These findings suggest that adrenal androgens do not play a major regulatory role on the HPT axis.
4. Discussion
THs are essential for human development, cellular differentiation and metabolism. While TH actions across various tissues are well- characterized, the potential bidirectional regulation between THs and adrenal androgens remains poorly understood. In H295R cells, our findings demonstrate that T3 modulates the expression of key ste- roidogenic enzymes involved in (adrenal) androgen biosynthesis. In patients with CAH, we observed correlations between serum fT4 and TSH concentrations and adrenal androgens; however, normal versus elevated androgen concentrations did not differentially affect thyroid status, suggesting that (adrenal) androgens do not exert regulatory ef- fects on the HPT axis.
In H295R cells, T3 treatment led to reduced secretion of DHEA and DHEAS, accompanied by a slight increase in T and A4 production in our study. This shift in steroid output was associated with upregulation of HSD3B2, consistent with previous findings [13], and downregulation of CYP17A1, effectively reversing the zR-specific expression profile re- ported for high DHEA and DHEAS production. Additionally, expressions of PAPSS2 and SULT2A1 were modestly reduced in our study, but this
did not translate into altered calculated SULT2A1 enzyme activity, again consistent with published observations [13]. Similarly, CYP11A1 expression was downregulated, yet P5 production remained constant. In contrast, 11OHA4/A4 ratio, as well as cortisol and aldosterone pro- duction, were increased by T3, even though gene expression of the involved enzymes CYP11B1 and CYP11B2, respectively, were not altered. These discrepancies may reflect subtle transcript changes that are insufficient to affect enzyme activity or suggest that T3 may exert additional regulatory effects at the post-transcriptional, post — translational level. We also observed T3-induced upregulation of AKR1C3 expression and activity, indicative for the presence of a T3-THRß1-positive zone as described for the inner cortex in mice which governs 20&HSD activity, the murine ortholog of human AKR1C3 [15]. Furthermore, the AKR1C2 transcript, coding for an enzyme inactivating DHT via hydroxylation [42], was also upregulated in our study. This could explain the unchanged DHT output despite increased T produc- tion, but this remains hypothetical as downstream metabolites of DHT were not measured.
In addition to genes directly involved in adrenal steroid biosynthesis, T3 also modulated gene expression of steroid-metabolizing enzymes, notably upregulating GSTA1, GSTA2 and CYP3A5. Previous studies have shown that GSTA1 and GSTA3 catalyze 45-44 steroid isomerization in H295R cells [43]. Therefore, the observed increase in P4/P5, 17OHP4/17OHP5 and A4/DHEA ratios in our experiments may not only reflect enhanced HSD3B2 activity but could also be attributed to elevated GSTA1 expression. By contrast, the functional significance of CYP3A5 upregulation remains uncertain, as adrenal CYP3A5 does not seem to contribute substantially to overall steroid metabolism, although T could be a substrate for this enzyme leading to downstream hydrox- ylated T metabolites [44]. In contrast to previous findings where T3 upregulated POR transcription [14], we did not measure differential expression of POR. This discrepancy might be attributed to different experimental conditions used, including different cell lines (H295A versus H295R) that have been shown to differ in steroidogenesis [45], T3 concentrations as well as incubation timings. Of note, in our study, sums of assessed steroids remained constant, indicating substrate availability for overall steroidogenesis was not affected by T3. Accord- ingly, we did not detect transcriptional changes in genes responsible for cholesterol biosynthesis, which contrasts with findings in mice studies [16,17].
In our H295R cell experiments, T3 also targeted several signaling factors crucial for zR function. DUSP6 was downregulated, consistent with previous reports implicating it in androgen regulation via CYP17A1 in H295R cells [46]. Furthermore, the ACTH-receptor MC2R was downregulated by T3 in our study. MC2R is a key driver of adrenal androgen production and adrenocortical zonation [47,48]. Notably, MC2R expression varies among different H295 cell lines, with the R-line used in our study exhibiting higher MC2R expression and thus stronger ACTH-signaling [45,49-51]. This variability provides an additional explanation for the divergent findings reported across H295 cell
| fT4 | - R2 (corrected) | TSH | ||||
|---|---|---|---|---|---|---|
| Coefficient | p value | Coefficient | p value | R2 (corrected) | ||
| A4 | -0.051 | 0.018 | 0.368 | -0.003 | 0.906 | 0.320 |
| DHEA | -0.088 | 0.014 | 0.251 | -0.094 | 0.018 | 0.247 |
| Androsterone | -0.006 | 0.036 | 0.323 | -0.008 | 0.013 | 0.338 |
| DHT | 0.002 | 0.252 | 0.402 | -0.004 | 0.023 | 0.432 |
| DHEAS | -4.528 | 0.494 | 0.206 | -7.357 | 0.315 | 0.212 |
| T | 0.052 | 0.097 | 0.365 | -0.068 | 0.051 | 0.374 |
| 11OHA4 | -0.036 | 0.253 | 0.174 | 0.013 | 0.717 | 0.160 |
| 11KA4 | -0.006 | 0.366 | 0.017 | 0.009 | 0.229 | 0.025 |
| 11OHT | -0.003 | 0.327 | 0.218 | 0.002 | 0.512 | 0.212 |
| 11KT | -0.022 | 0.371 | 0.040 | -0.008 | 0.764 | 0.031 |
A
2
20
20
DHEA (adj.)
Androsterone (adj.)
1
A4 (adj.)
10
10
0
0
0
-10
-1
-10
-50
-25
0
25
50
-50
-25
25
50
-50
-25
0
25
50
fT4 (ranks)
fT4 (ranks)
0
fT4 (ranks)
B
Androsterone (adj.)
2
20
2
DHEA (adj.)
10
1
DHT (adj.)
1
0
0
0
-10
-1
-40
-20
0
20
40
60
-40
-20
0
20
40
60
-1
-40
-20
0
20
40
60
TSH (ranks)
TSH (ranks)
TSH (ranks)
A
B
Undertreated (hyperandrogenic)
Well treated
Undertreated (hyperandrogenic)
Well treated
p = 0,41
p = 0,62
100
2
100
80
0
80
159
fT4 (ranks)
TSH (ranks)
8157
60
60
40
40
20
20
0
0
experiments.
Other identified signaling factors targeted by T3 in our study included members of the ß-catenin/WNT and SHH signaling pathways, namely CTNBB1, WNT4 and SHH. It is known that CTNNB1/ß-catenin (central mediator of canonical WNT pathway), WNT4 (a context- dependent WNT ligand), and SHH (Sonic hedgehog) form a core axis that patterns the adrenal cortex, sustains capsular and subcapsular progenitors, and restrains or permits lineage commitment to adrenal zones and thus zone-specific functions [52]. Specifically, CTNBB1 is crucial for determining zG identity in vivo and in vitro [53,54], WNT4 ligand is an important driver of zG differentiation [40], whereas SHH signaling is essential for adrenal development [55,56]. In our study, T3 increased WNT4 expression but decreased CTNBB1 and SHH, factors that typically act synergistically. This divergence makes it challenging to reconcile our findings with current knowledge. Nevertheless, given that overall T3 stimulation altered zR function, we speculate that reduced ß-catenin and SHH signaling may increase differentiation pressure to- ward inner-zones (zF/zR), consistent with T3 effects on androgen-relevant enzymes. Importantly, H295R cells harbor activating mutations in CTNNB1 [57-59], resulting in constitutive WNT pathway
activation. Thus, direct extrapolation of our cell-based findings to human physiology should be made with caution.
Other genes of interest for adrenal androgen production found through this study included highly upregulated IGFBP7 and MGARP. IGFBP7 binds insulin with high affinity and blocks its receptor [60], potentially counteracting insulin stimulation effect on SULT2A1 activ- ity, which has been demonstrated in human adrenal tissue and H295R cells [61,62]. MGARP, which is highly expressed in the adrenal gland [63], has been shown to modulate mitochondrial morphology [64] and to enhance progesterone production in murine adrenocortical cells [65].
Furthermore, we identified several factors associated with sex dif- ferentiation, including upregulated INHA and downregulated AMHR2, both described to influence the hypothalamic-pituitary-gonadal (HPG) axis [66,67], whereas their role for adrenal androgen production re- mains less understood.
T3 also downregulated CYP19A1, the enzyme responsible for con- verting androgens into estrogens. This contrasts with findings in mouse granulosa cells where T3 treatment led to increased CYP19A1 expres- sion [68].
By contrast, T3 did not affect transcription of DIO1 and DIO2, which
are both expressed in human adrenals [63] and H295R cells [69,70]. This indicates that T3 does not promote its own conversion from circulating T4 in the adrenal cortex. Importantly, although THRA and THRB are both expressed in human adrenals [63] and H295R cells [69, 70], the main nuclear receptor mediating the T3 response in our study was THRB, and it was highly upregulated in contrast to THRA. Consis- tently, TRß1 receptors were also found upregulated in the murine X-zone following T3 treatment [15] and in hyperthyroid mice [17]. Our computational analysis of promoter regions suggested that T3/THRB-TRE may directly regulate gene transcription of key players involved in adrenal zonation and androgen production, such as SHH and PAPSS2. However, since the identified sequences share low similarity across various vertebrates, further experimental studies are needed to establish a direct regulatory role of T3/THRB on those genes. In addi- tion, differential gene expression may also occur indirectly. Because T3 regulates genes encoding transcription factors and cofactors, cells can exhibit a secondary response to T3 stimulation driven by the increased expression of these target genes [71]. Indeed, it has been estimated that as early as 3 h after T3 stimulation of cultured cells, approximately 20 % of transcript changes may reflect secondary responses [72]. Indirect effects are also possible through competition of THRB with other tran- scription factors involved in steroidogenesis. For example, RARs are efficient heterodimer partners for THRB [23] and are themselves known as regulators of steroidogenesis [46]. Thus, increased THRB levels may reduce the pool of free RARs, limiting their availability for other tran- scriptional functions.
Given the regulatory role of THs in adrenal androgen production at the cellular level, we also investigated potential crosstalk between the HPT and HPA axes in human physiology, both under normal conditions and in disease states. In polycystic ovary syndrome (PCOS), a condition characterized by androgen excess, THs have been shown to influence the HPG axis, impairing gonadotropin release, ovarian steroidogenesis and follicular development [73-75]. Although several clinical studies have reported correlations between thyroid and adrenal hormones, no one has investigated this relationship in the context of CAH (Suppl. Table 1 [17,27-29,35,76-86]). Our study found weak negative correlations between fT4 and DHEA, androsterone and A4 , as well as between TSH and DHEA, androsterone and DHT. These findings suggest that THs may regulate zR function in CAH patients. The negative correlation with DHEA supports our cell model results, where T3 downregulated DHEA levels. However, the regulatory relationship appears to be more com- plex, as the association between THs and adrenal hormones varies across different disease states (Suppl. Table 1). For instance, in PA, a hyper- androgenic condition comparable to PCOS and CAH, fT4 negatively correlated with T, consistent with the negative fT4 correlations observed in our CAH cohort. In contrast, hypothyroidism is associated with a tendency toward decreased DHEA and DHEAS, while hyperthyroidism shows increased DHEAS and no effect on DHEA levels. Notably, in healthy individuals, studies report mostly no significant associations. These observations suggest that disease states significantly influence how THs regulate adrenal androgen production.
Inspired by our findings, we hypothesized that the correlations observed in our CAH cohort might not only reflect THs regulation of the zR, but also a feedback effect of adrenal androgens on the HPT axis. To test this, we compared well-treated and hyperandrogenic, undertreated patients with CAH. Upon analyzing serum fT4 and TSH concentrations, we found no difference between the two groups. This suggests that the HPT axis is not significantly influenced by circulating androgens. Sup- porting this conclusion, previous studies have shown that androgen administration does not affect serum fT4 in euthyroid breast cancer patients [87]. Similarly, androgen administration did not alter serum TSH concentrations in rats [88]. However, thyroid hormone data assessed in transgender adolescents under testosterone treatment show ambiguous results [89,90]. By contrast, in patients with autoimmune hypothyroidism DHEA administration has been reported to decrease serum TSH [91]. In rats with defective insulin secretion, DHEA
treatment reduced both total and free serum T4 [92].
Finally, it should be noted that our findings of decreased DHEA and DHEAS production in the H295R cell line contrast with clinical obser- vations of elevated circulating DHEAS in hyperthyroidism and reduced DHEA and DHEAS in hypothyroidism (Suppl. Table 1). Several expla- nations for this discrepancy are plausible: 1) H295R cells are a well- established cell model of the human adrenal cortex but represent over- all steroidogenesis and no specific pathway, as present in the different zones of the human adrenal cortex (e.g. zR) that are regulated differ- entially [93]; 2) Although T3 may acutely decrease DHEA and DHEAS production by directly modulating gene expression in the zR, it might also promote zR growth over long-term thereby leading to increased DHEA and DHEAS synthesis. Indeed, adrenal X-zones in hyperthyroid mice were hypertrophic, whereas hypothyroid mice exhibited poorly developed X-zones [17]; 3) T3 may inhibit peripheral DHEA conversion into more potent androgens, resulting in DHEA accumulation; 4) other underlying factors associated with thyroid disorders may counteract or override the T3-mediated suppression of DHEA and DHEAS synthesis; 5) Although T3 might downregulate DHEA/S production in the adrenals, it might simultaneously enhance hepatic SULT2A1 activity. Indeed, THRA-overexpressing HepG2 hepatoma cells exhibited increased SULT2A1 expression following T3 treatment [94].
In summary, this study shows that THs regulate adrenal androgen production in vitro by modulating the steroidogenic gene expression machinery. In contrast, clinical data from pediatric patients with CAH indicate that adrenal androgens do not exert regulatory effects on THs and the HPT axis.
CRediT authorship contribution statement
Emre Murat Altinkiliç: Methodology, Conceptualization. Therina du Toit: Writing - review & editing, Formal analysis, Conceptualization. Philipp Augsburger: Writing - original draft, Visualization, Method- ology, Investigation, Formal analysis, Conceptualization. van den Akker Erica: Writing - review & editing, Resources. Evangelia Char- mandari: Writing - review & editing, Resources. Christiaan de Bruin: Writing - review & editing, Resources. Hannima Sabine: Writing - review & editing, Resources. Flueck Christa: Writing - original draft, Supervision, Resources, Project administration, Methodology, Conceptualization.
Declaration of Generative AI and AI-assisted technologies in the writing process
During the preparation of this work, the authors used Copilot and ChatGPT to correct grammar and spelling mistakes. After using these tools, the authors reviewed and edited the content as needed and take full responsibility for the content of the published article.
Funding
This work was supported by grants of the Swiss National Science Foundation (320030-207893 and IZSEZ0-211810), the Research Unit of the European Society for Pediatric Endocrinology and by a donation of the OAK Foundation, Switzerland.
Declaration of Competing Interest
The authors declare the following financial interests/personal re- lationships which may be considered as potential competing interests: Christa E. Flueck reports financial support was provided by Swiss Na- tional Science Foundation. Therina du Toit reports financial support was provided by Swiss National Science Foundation. Christa E. Flueck re- ports financial support was provided by Research Unit of the European Society for Pediatric Endocrinology (ESPE). Christa E. Flueck reports financial support was provided by OAK Foundation, Switzerland. If
there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgements
The authors thank all CAH patients and their families for partici- pating in the study.
Appendix A. Supporting information
Supplementary data associated with this article can be found in the online version at doi:10.1016/j.jsbmb.2026.106939.
Data availability
The transcriptome profiling data has been deposited in Mendeley Data, V1, https://doi.org/10.17632/2s693wxfgp.1. The clinical data is confidential.
Trancriptome Profiling and Pathway Analysis in H295R cells upon T3 treatment (Mendeley Data)
References
[1] P.J. Hornsby, Aging of the human adrenal cortex, re6, Sci. Aging Knowl. Environ. 2004 (35) (2004 Sep 1), https://doi.org/10.1126/sageke.2004.35.re6.
[2] W.E. Rainey, B.R. Carr, H. Sasano, T. Suzuki, J.I. Mason, Dissecting human adrenal androgen production, Trends Endocrinol. Metab. 13 (6) (2002 Aug) 234-239, https://doi.org/10.1016/s1043-2760(02)00609-4.
[3] J. Rege, Y. Nakamura, T. Wang, T.D. Merchen, H. Sasano, W.E. Rainey, Transcriptome profiling reveals differentially expressed transcripts between the human adrenal zona fasciculata and zona reticularis, J. Clin. Endocrinol. Metab. 99 (3) (2014 Mar) E518-E527, https://doi.org/10.1210/jc.2013-3198.
[4] T. Suzuki, H. Sasano, J. Takeyama, C. Kaneko, W.A. Freije, B.R. Carr, W.E. Rainey, Developmental changes in steroidogenic enzymes in human postnatal adrenal cortex: immunohistochemical studies, Clin. Endocrinol. (Oxf. ) 53 (6) (2000 Dec) 739-747, https://doi.org/10.1046/j.1365-2265.2000.01144.x.
[5] W. Regelson, R. Loria, M. Kalimi, Dehydroepiandrosterone (DHEA)-the “mother steroid”. I. Immunologic action, Ann. N. Y Acad. Sci. 719 (1994 May 31) 553-563, https://doi.org/10.1111/j.1749-6632.1994.tb56859.x.
[6] J.W. Mueller, J. Idkowiak, T.F. Gesteira, C. Vallet, R. Hardman, J. van den Boom, V. Dhir, S.K. Knauer, E. Rosta, W. Arlt, Human DHEA sulfation requires direct interaction between PAPS synthase 2 and DHEA sulfotransferase SULT2A1, J. Biol. Chem. 293 (25) (2018 Jun 22) 9724-9735, https://doi.org/10.1074/jbc. RA118.002248.
[7] E.O. Reiter, V.G. Fuldauer, A.W. Root, Secretion of the adrenal androgen, dehydroepiandrosterone sulfate, during normal infancy, childhood, and adolescence, in sick infants, and in children with endocrinologic abnormalities, J. Pedia 90 (5) (1977 May) 766-770, https://doi.org/10.1016/s0022-3476(77) 81244-4.
[8] P.J. Hornsby, Biosynthesis of DHEAS by the human adrenal cortex and its age- related decline, Ann. N. Y Acad. Sci. 774 (1995 Dec 29) 29-46, https://doi.org/ 10.1111/j.1749-6632.1995.tb17370.x.
[9] A.F. Turcu, J. Rege, R.J. Auchus, W.E. Rainey, 11-Oxygenated androgens in health and disease, Nat. Rev. Endocrinol. 16 (5) (2020 May) 284-296, https://doi.org/ 10.1038/s41574-020-0336-x.
[10] P.T. Herring, The influence of the thyroids on the functions of the suprarenals, Endocrinology 4 (1920) 577-599, 10.1210/endo- 4-4-577.
[11] C. Benelli, O. Michel, R. Michel, Effect of thyroidectomy on pregnenolone and progesterone biosynthesis in rat adrenal cortex, J. Steroid Biochem 16 (6) (1982 Jun) 749-754, https://doi.org/10.1016/0022-4731(82)90031-0.
[12] J.G. Shire, W.G. Beamer, Adrenal changes in genetically hypothyroid mice, J. Endocrinol. 102 (3) (1984 Sep) 277-280, https://doi.org/10.1677/ joe.0.1020277.
[13] M.H. Simonian, ACTH and thyroid hormone regulation of 3 beta-hydroxysteroid dehydrogenase activity in human fetal adrenocortical cells, J. Steroid Biochem. 25 (6) (1986 Dec) 1001-1006, https://doi.org/10.1016/0022-4731(86)90336-5.
[14] M.K. Tee, N. Huang, I. Damm, W.L. Miller, Transcriptional regulation of the human P450 oxidoreductase gene: hormonal regulation and influence of promoter polymorphisms, Mol. Endocrinol. 25 (5) (2011 May) 715-731, https://doi.org/ 10.1210/me.2010-0236.
[15] C.C. Huang, C. Kraft, N. Moy, L. Ng, D. Forrest, A novel population of inner cortical cells in the adrenal gland that displays sexually dimorphic expression of thyroid hormone receptor-ß1, Endocrinology 156 (6) (2015 Jun) 2338-2348, https://doi. org/10.1210/en.2015-1118.
[16] Q. Lyu, H. Wang, Y. Kang, X. Wu, H.S. Zheng, K. Laprocina, K. Junghans, X. Ding, C.C. Huang, RNA-seq reveals sub-zones in mouse adrenal zona fasciculata and the
sexually dimorphic responses to thyroid hormone, Endocrinology 161 (9) (2020 Sep 1) bqaa126, https://doi.org/10.1210/endocr/bqaa126.
[17] K. Patyra, C. Löf, H. Jaeschke, H. Undeutsch, H.S. Zheng, S. Tyystjärvi, K. Puławska, M. Doroszko, 641, M. Chruściel, B.M. Loo, R. Kurkijärvi, F.P. Zhang, C.J. Huang, C. Ohlsson, A. Kero, M. Poutanen, J. Toppari, R. Paschke, N. Rahman, I. Huhtaniemi, J. Jääskeläinen, J. Kero, Congenital hypothyroidism and hyperthyroidism alters adrenal gene expression, development, and function, Thyroid 32 (4) (2022 Apr) 459-471, https://doi.org/10.1089/thy.2021.0535.
[18] K. Petrowski, G.J. Kahaly, Stress and thyroid function-from bench to bedside, Endocr. Rev. 46 (5) (2025 Sep 16) 709-735, https://doi.org/10.1210/endrev/ bnaf015.
[19] A. Taurog, M.L. Dorris, D.R. Doerge, Minocycline and the thyroid: antithyroid effects of the drug, and the role of thyroid peroxidase in minocycline-induced black pigmentation of the gland, Thyroid 6 (3) (1996 Jun) 211-219, https://doi.org/ 10.1089/thy.1996.6.211.
[20] St Germain, D.L. Galton, VA. The deiodinase family of selenoproteins, Thyroid 7 (4) (1997 Aug) 655-668, https://doi.org/10.1089/thy.1997.7.655.
[21] M.A. Lazar, Thyroid hormone receptors: multiple forms, multiple possibilities, Endocr. Rev. 14 (2) (1993 Apr) 184-193, https://doi.org/10.1210/edrv-14-2-184.
[22] D.J. Mangelsdorf, R.M. Evans, The RXR heterodimers and orphan receptors, Cell 83 (6) (1995 Dec 15) 841-850, https://doi.org/10.1016/0092-8674(95)90200-7.
[23] S. Lee, M.L. Privalsky, Heterodimers of retinoic acid receptors and thyroid hormone receptors display unique combinatorial regulatory properties, Mol. Endocrinol. 19 (4) (2005 Apr) 863-878, https://doi.org/10.1210/me.2004-0210.
[24] R.T. Zoeller, S.W. Tan, R.W. Tyl, General background on the hypothalamic- pituitary-thyroid (HPT) axis, Crit. Rev. Toxicol. 37 (1-2) (2007 Jan-Feb) 11-53, https://doi.org/10.1080/10408440601123446.
[25] I. Tambones, A. le Maire, Structural insights into thyroid hormone receptors, Endocrinology 166 (1) (2024 Nov 26) bqae154, https://doi.org/10.1210/endocr/ bqae154.
[26] C.C. Huang, Y. Kang, The transient cortical zone in the adrenal gland: the mystery of the adrenal X-zone, J. Endocrinol. 241 (1) (2019 Apr) R51-R63, https://doi.org/ 10.1530/JOE-18-0632.
[27] N. Tagawa, T. Takano, S. Fukata, K. Kuma, H. Tada, Y. Izumi, Y. Kobayashi, N. Amino, Serum concentration of androstenediol and androstenediol sulfate in patients with hyperthyroidism and hypothyroidism, Endocr. J. 48 (3) (2001 Jun) 345-354, https://doi.org/10.1507/endocrj.48.345.
[28] T. Siriwardhane, K. Krishna, Q. Song, V. Ranganathan, V. Jayaraman, T. Wang, K. Bei, J. Rajasekaran, H. Krishnamurthy, Human reproductive health in relation to thyroid alterations, Health 11 (2019) 1095-1133, https://doi.org/10.4236/ health.2019.118086.
[29] G. Gonulalan, Y. Tanrıkulu, Relationship of dehydroepiandrosterone sulfate levels with atherosclerosis in patients with subclinical hypothyroidism, Wien. Klin. Woche 134 (1-2) (2022 Jan) 45-50, https://doi.org/10.1007/s00508-021-01844- 9.
[30] E. Missaghian, P. Kempná, B. Dick, A. Hirsch, R. Alikhani-Koupaei, B. Jégou, P. E. Mullis, B.M. Frey, C.E. Flück, Role of DNA methylation in the tissue-specific expression of the CYP17A1 gene for steroidogenesis in rodents, J. Endocrinol. 202 (1) (2009 Jul) 99-109, https://doi.org/10.1677/JOE-08-0353.
[31] T. Dumontet, A. Martinez, Adrenal androgens, adrenarche, and zona reticularis: a human affair? Mol. Cell Endocrinol. 528 (2021 May 15) 111239 https://doi.org/ 10.1016/j.mce.2021.111239.
[32] A. Ishisaki, H. Tokuda, M. Yoshida, K. Hirade, K. Kunieda, D. Hatakeyama, T. Shibata, O. Kozawa, Activation of p38 mitogen-activated protein kinase mediates thyroid hormone-stimulated osteocalcin synthesis in osteoblasts, Mol. Cell Endocrinol. 214 (1-2) (2004 Feb 12) 189-195, https://doi.org/10.1016/j. mce.2003.10.049.
[33] X. Chen, Y. Hu, T. Jiang, C. Xia, Y. Wang, Y. Gao, Triiodothyronine potentiates BMP9-induced osteogenesis in mesenchymal stem cells through the activation of AMPK/p38 signaling, Front Cell Dev. Biol. 8 (2020 Jul 31) 725, https://doi.org/ 10.3389/fcell.2020.00725.
[34] M.K. Tee, W.L. Miller, Phosphorylation of human cytochrome P450c17 by p38x selectively increases 17,20 lyase activity and androgen biosynthesis, J. Biol. Chem. 288 (33) (2013 Aug 16) 23903-23913, https://doi.org/10.1074/jbc. M113.460048.
[35] E.M. Kyritsi, I.A. Vasilakis, I. Kosteria, A. Mantzou, A. Gryparis, E. Kassi, G. Kaltsas, C. Kanaka-Gantenbein, High frequency of autoimmune thyroiditis in euthyroid girls with premature adrenarche, Front. Pedia 11 (2023 Mar 16) 1064177, https:// doi.org/10.3389/fped.2023.1064177.
[36] T. Andrieu, T. du Toit, B. Vogt, M.D. Mueller, M. Groessl, Parallel targeted and non- targeted quantitative analysis of steroids in human serum and peritoneal fluid by liquid chromatography high-resolution mass spectrometry, Anal. Bioanal. Chem. 414 (25) (2022 Oct) 7461-7472, https://doi.org/10.1007/s00216-022-03881-3.
[37] O. Abawi, G. Sommer, M. Grössl, U. Halbsguth, T. du Toit, S.E. Hannema, C. de Bruin, E. Charmandari, E.L.T. van den Akker, A.B. Leichtle, C.E. Flück, Predicting treatment outcome in congenital adrenal hyperplasia using urine steroidomics and machine learning, Eur. J. Endocrinol. 193 (1) (2025 Jun 30) 10-20, https://doi. org/10.1093/ejendo/lvaf121.
[38] C. Raftopoulou, O. Abawi, G. Sommer, M. Binou, G. Paltoglou, C.E. Flück, E.L. T. van den Akker, E. Charmandari, Leukocyte telomere length in children with congenital adrenal hyperplasia, J. Clin. Endocrinol. Metab. 108 (2) (2023 Jan 17) 443-452, https://doi.org/10.1210/clinem/dgac560.
[39] P.W. Speiser, W. Arlt, R.J. Auchus, L.S. Baskin, G.S. Conway, D.P. Merke, H.F. L. Meyer-Bahlburg, W.L. Miller, M.H. Murad, S.E. Oberfield, P.C. White, Congenital adrenal hyperplasia due to steroid 21-hydroxylase deficiency: an endocrine society
clinical practice guideline, J. Clin. Endocrinol. Metab. 103 (11) (2018 Nov 1) 4043-4088, https://doi.org/10.1210/jc.2018-01865.
[40] C. Drelon, A. Berthon, I. Sahut-Barnola, M. Mathieu, T. Dumontet, S. Rodriguez, M. Batisse-Lignier, H. Tabbal, I. Tauveron, A.M. Lefrançois-Martinez, J.C. Pointud, C.E. Gomez-Sanchez, S. Vainio, J. Shan, S. Sacco, A. Schedl, C.A. Stratakis, A. Martinez, P. Val, PKA inhibits WNT signalling in adrenal cortex zonation and prevents malignant tumour development, Nat. Commun. 7 (2016 Sep 14) 12751, https://doi.org/10.1038/ncomms12751.
[41] I. Finco, A.M. Lerario, G.D. Hammer, Sonic hedgehog and WNT signaling promote adrenal gland regeneration in male mice, Endocrinology 159 (2) (2018 Feb 1) 579-596, https://doi.org/10.1210/en.2017-03061.
[42] S. Steckelbroeck, Y. Jin, S. Gopishetty, B. Oyesanmi, T.M. Penning, Human cytosolic 3alpha-hydroxysteroid dehydrogenases of the aldo-keto reductase superfamily display significant 3beta-hydroxysteroid dehydrogenase activity: implications for steroid hormone metabolism and action, J. Biol. Chem. 279 (11) (2004 Mar 12) 10784-10795, https://doi.org/10.1074/jbc.M313308200.
[43] T. Matsumura, Y. Imamichi, T. Mizutani, Y. Ju, T. Yazawa, S. Kawabe, M. Kanno, T. Ayabe, N. Katsumata, M. Fukami, M. Inatani, Y. Akagi, A. Umezawa, T. Ogata, K. Miyamoto, Human glutathione S-transferase A (GSTA) family genes are regulated by steroidogenic factor 1 (SF-1) and are involved in steroidogenesis, FASEB J. 27 (8) (2013 Aug) 3198-3208, https://doi.org/10.1096/fj.12-222745.
[44] T. Niwa, A. Okamoto, K. Narita, M. Toyota, K. Kato, K. Kobayashi, S. Sasaki, Comparison of steroid hormone hydroxylation mediated by cytochrome P450 3A subfamilies, Arch. Biochem Biophys. 682 (2020 Mar 30) 108283, https://doi.org/ 10.1016/j.abb.2020.108283.
[45] E. Samandari, P. Kempná, J.M. Nuoffer, G. Hofer, P.E. Mullis, C.E. Flück, Human adrenal corticocarcinoma NCI-H295R cells produce more androgens than NCI- H295A cells and differ in 3beta-hydroxysteroid dehydrogenase type 2 and 17,20 lyase activities, J. Endocrinol. 195 (3) (2007 Dec) 459-472, https://doi.org/ 10.1677/JOE-07-0166.
[46] S.S. Udhane, A.V. Pandey, G. Hofer, P.E. Mullis, C.E. Flück, Retinoic acid receptor beta and angiopoietin-like protein 1 are involved in the regulation of human androgen biosynthesis, Sci. Rep. 5 (2015 May 13) 10132, https://doi.org/10.1038/ srep10132.
[47] A. Weber, A.J. Clark, L.A. Perry, J.W. Honour, M.O. Savage, Diminished adrenal androgen secretion in familial glucocorticoid deficiency implicates a significant role for ACTH in the induction of adrenarche, Clin. Endocrinol. 46 (4) (1997 Apr) 431-437, https://doi.org/10.1046/j.1365-2265.1997.1580969.x.
[48] T.V. Novoselova, M. Hussain, P.J. King, L. Guasti, L.A. Metherell, M. Charalambous, A.J.L. Clark, L.F. Chan, MRAP deficiency impairs adrenal progenitor cell differentiation and gland zonation, fj201701274RR, FASEB J. 32 (11) (2018 Jun 7), https://doi.org/10.1096/fj.201701274RR.
[49] I.M. Bird, N.A. Hanley, R.A. Word, J.M. Mathis, J.L. McCarthy, J.I. Mason, W. E. Rainey, Human NCI-H295 adrenocortical carcinoma cells: a model for angiotensin-II-responsive aldosterone secretion, Endocrinology 133 (4) (1993 Oct) 1555-1561, https://doi.org/10.1210/endo.133.4.8404594.
[50] W.E. Rainey, K. Saner, B.P. Schimmer, Adrenocortical cell lines, Mol. Cell Endocrinol. 228 (1-2) (2004 Dec 30) 23-38, https://doi.org/10.1016/j. mce.2003.12.020.
[51] T. Wang, W.E. Rainey, Human adrenocortical carcinoma cell lines, Mol. Cell Endocrinol. 351 (1) (2012 Mar 31) 58-65, https://doi.org/10.1016/j. mce.2011.08.041.
[52] E. Pignatti, S. Leng, D.L. Carlone, D.T. Breault, Regulation of zonation and homeostasis in the adrenal cortex, Mol. Cell Endocrinol. 441 (2017 Feb 5) 146-155, https://doi.org/10.1016/j.mce.2016.09.003.
[53] A. Berthon, I. Sahut-Barnola, S. Lambert-Langlais, C. de Joussineau, C. Damon- Soubeyrand, E. Louiset, M.M. Taketo, F. Tissier, J. Bertherat, A.M. Lefrançois- Martinez, A. Martinez, P. Val, Constitutive beta-catenin activation induces adrenal hyperplasia and promotes adrenal cancer development, Hum. Mol. Genet 19 (8) (2010 Apr 15) 1561-1576, https://doi.org/10.1093/hmg/ddq029.
[54] A. Berthon, C. Drelon, B. Ragazzon, S. Boulkroun, F. Tissier, L. Amar, B. Samson- Couterie, M.C. Zennaro, P.F. Plouin, S. Skah, M. Plateroti, H. Lefèbvre, I. Sahut- Barnola, M. Batisse-Lignier, G. Assié, A.M. Lefrançois-Martinez, J. Bertherat, A. Martinez, P. Val, WNT/ß-catenin signalling is activated in aldosterone- producing adenomas and controls aldosterone production, Hum. Mol. Genet 23 (4) (2014 Feb 15) 889-905, https://doi.org/10.1093/hmg/ddt484.
[55] P. King, A. Paul, E. Laufer, Shh signaling regulates adrenocortical development and identifies progenitors of steroidogenic lineages, Proc. Natl. Acad. Sci. USA 106 (50) (2009 Dec 15) 21185-21190, https://doi.org/10.1073/pnas.0909471106.
[56] A.M. Lerario, I. Finco, C. LaPensee, G.D. Hammer, Molecular mechanisms of stem/ progenitor cell maintenance in the adrenal cortex, Front. Endocrinol. 8 (2017 Mar 23) 52, https://doi.org/10.3389/fendo.2017.00052.
[57] E.M. Pinto, K. Kiseljak-Vassiliades, C. Hantel, Contemporary preclinical human models of adrenocortical carcinoma, Curr. Opin. Endocr. Metab. Res 8 (2019 Oct) 139-144, https://doi.org/10.1016/j.coemr.2019.08.009.
[58] S. Sigala, C. Bothou, D. Penton, A. Abate, M. Peitzsch, D. Cosentini, G.A.M. Tiberio, S.R. Bornstein, A. Berruti, C. Hantel, A comprehensive investigation of steroidogenic signaling in classical and new experimental cell models of adrenocortical carcinoma, Cells 11 (9) (2022 Apr 24) 1439, https://doi.org/ 10.3390/cells11091439. Erratum in: Cells. 2023 Sep 14;12(18):2274. doi: 10.3390/cells12182274.
[59] F. Tissier, C. Cavard, L. Groussin, K. Perlemoine, G. Fumey, A.M. Hagneré, F. René- Corail, E. Jullian, C. Gicquel, X. Bertagna, M.C. Vacher-Lavenu, C. Perret, J. Bertherat, Mutations of beta-catenin in adrenocortical tumors: activation of the Wnt signaling pathway is a frequent event in both benign and malignant
adrenocortical tumors, Cancer Res. 65 (17) (2005 Sep 1) 7622-7627, https://doi. org/10.1158/0008-5472.CAN-05-0593.
[60] W. Ruan, Z. Kang, Y. Li, T. Sun, L. Wang, L. Liang, M. Lai, T. Wu, Interaction between IGFBP7 and insulin: a theoretical and experimental study, Sci. Rep. 6 (2016 Apr 22) 19586, https://doi.org/10.1038/srep19586.
[61] G.A. Hines, E.R. Smith, R. Azziz, Influence of insulin and testosterone on adrenocortical steroidogenesis in vitro: preliminary studies, Fertil. Steril. 76 (4) (2001 Oct) 730-735, https://doi.org/10.1016/s0015-0282(01)02014-3.
[62] A. Kumar, D. Magoffin, I. Munir, R. Azziz, Effect of insulin and testosterone on androgen production and transcription of SULT2A1 in the NCI-H295R adrenocortical cell line, Fertil. Steril. 92 (2) (2009 Aug) 793-797, https://doi.org/ 10.1016/j.fertnstert.2008.05.076.
[63] K. Nishimoto, S.A. Tomlins, R. Kuick, A.K. Cani, T.J. Giordano, D.H. Hovelson, C. J. Liu, A.R. Sanjanwala, M.A. Edwards, C.E. Gomez-Sanchez, K. Nanba, W. E. Rainey, Aldosterone-stimulating somatic gene mutations are common in normal adrenal glands [dataset], Gene Expression Omnibus (GEO) database (2015). (www. ncbi.nlm.nih.gov/geo) (accession no. GSE68889).
[64] S. Zhang, MGARP is ultrastructurally located in the inner faces of mitochondrial membranes, Biochem. Biophys. Res Commun. 516 (1) (2019 Aug 13) 138-143, https://doi.org/10.1016/j.bbrc.2019.06.028.
[65] T. Matsumoto, K. Minegishi, H. Ishimoto, M. Tanaka, J.D. Hennebold, T. Teranishi, Y. Hattori, M. Furuya, T. Higuchi, S. Asai, S.H. Kim, K. Miyakoshi, Y. Yoshimura, Expression of ovary-specific acidic protein in steroidogenic tissues: a possible role in steroidogenesis, Endocrinology 150 (7) (2009 Jul) 3353-3359, https://doi.org/ 10.1210/en.2008-1584.
[66] B. Barakat, C. Itman, S.H. Mendis, K.L. Loveland, Activins and inhibins in mammalian testis development: new models, new insights, Mol. Cell Endocrinol. 359 (1-2) (2012 Aug 15) 66-77, https://doi.org/10.1016/j.mce.2012.02.018.
[67] M.S.B. Silva, P. Giacobini, New insights into anti-Müllerian hormone role in the hypothalamic-pituitary-gonadal axis and neuroendocrine development, Cell Mol. Life Sci. 78 (1) (2021 Jan) 1-16, https://doi.org/10.1007/s00018-020-03576-x.
[68] J. Liu, Y. Han, Y. Tian, X. Weng, X. Hu, W. Liu, D. Heng, K. Xu, Y. Yang, C. Zhang, Regulation by 3,5,3’-tri-iodothyronine and FSH of cytochrome P450 family 19 (CYP19) expression in mouse granulosa cells, Reprod. Fertil. Dev. 30 (9) (2018 Aug) 1225-1233, https://doi.org/10.1071/RD17362.
[69] S.H. Kim, H.J. Kim, J.W. Jung, S. Chung, G.H. Son, Transcriptomic data of human adrenocortical NCI-H295R cells treated with cortisol biosynthesis inhibitors, Data Brief. 52 (2023 Dec 12) 109948, https://doi.org/10.1016/j.dib.2023.109948.
[70] K. Wellman, R. Fu, A. Baldwin, J. Rege, E. Murphy, W.E. Rainey, N. Mukherjee, Transcriptomic response dynamics of human primary and immortalized adrenocortical cells to steroidogenic stimuli, Cells 10 (9) (2021 Sep 9) 2376, https://doi.org/10.3390/cells10092376.
[71] F. Chatonnet, F. Flamant, B. Morte, A temporary compendium of thyroid hormone target genes in brain, Biochim. Biophys. Acta 1849 (2) (2015 Feb) 122-129, https://doi.org/10.1016/j.bbagrm.2014.05.023.
[72] J.Z. Lin, D.H. Sieglaff, C. Yuan, J. Su, A.S. Arumanayagam, S. Firouzbakht, J. J. Cantu Pompa, F.D. Reynolds, X. Zhou, A. Cvoro, P. Webb, Gene specific actions of thyroid hormone receptor subtypes, PLoS One 8 (1) (2013) e52407, https://doi. org/10.1371/journal.pone.0052407.
[73] G.R. Sridhar, G. Nagamani, Hypothyroidism presenting with polycystic ovary syndrome, J. Assoc. Physicians India 41 (2) (1993 Feb) 88-90.
[74] K.A. Hansen, S.P. Tho, M. Hanly, R.W. Moretuzzo, P.G. McDonough, Massive ovarian enlargement in primary hypothyroidism, Fertil. Steril. 67 (1) (1997 Jan) 169-171, https://doi.org/10.1016/s0015-0282(97)81876-6.
[75] A. Panico, G.A. Lupoli, F. Fonderico, S. Colarusso, F. Marciello, M.R. Poggiano, M. Del Prete, R. Magliulo, P. Iervolino, G. Lupoli, Multiple ovarian cysts in a young girl with severe hypothyroidism, Thyroid 17 (12) (2007 Dec) 1289-1293, https:// doi.org/10.1089/thy.2007.0056.
[76] S. Galanou, G. Chouliaras, P. Girginoudis, C. Mengreli, A. Sertedaki, M. Dracopoulou, I. Farakla, D. Platis, A. Iliadi, G.P. Chrousos, C. Dacou-Voutetakis, E. Zoumakis, A.M. Magiakou, C. Kanaka-Gantenbein, A. Voutetakis, Adrenal steroids in female hypothyroid neonates: unraveling an association between thyroid hormones and adrenal remodeling, J. Clin. Endocrinol. Metab. 104 (9) (2019 Sep 1) 3996-4004, https://doi.org/10.1210/jc.2018-02013.
[77] R. Hampl, M. Hill, R. Bílek, L. Stárka, Relationship of dehydroepiandrosterone and its 7-hydroxylated metabolites to thyroid parameters and sex hormone-binding globulin (SHBG) in healthy subjects, Clin. Chem. Lab Med. 41 (8) (2003 Aug) 1081-1086, https://doi.org/10.1515/CCLM.2003.167.
[78] F.J. Peng, P. Palazzi, S. Mezzache, N. Bourokba, J. Soeur, B.M.R. Appenzeller, Profiling steroid and thyroid hormones with hair analysis in a cohort of women aged 25-45 years old, Eur. J. Endocrinol. 186 (5) (2022 Mar 18) K9-K15, https:// doi.org/10.1530/EJE-22-0081.
[79] G. Ravaglia, P. Forti, F. Maioli, L. Sacchetti, V. Nativio, C.R. Scali, E. Mariani, V. Zanardi, A. Stefanini, P.L. Macini, Dehydroepiandrosterone-sulfate serum levels and common age-related diseases: results from a cross-sectional Italian study of a general elderly population, Exp. Gerontol. 37 (5) (2002 May) 701-712, https:// doi.org/10.1016/s0531-5565(01)00232-7.
[80] G. Ravaglia, P. Forti, F. Maioli, F. Boschi, M. Bernardi, L. Pratelli, A. Pizzoferrato, G. Gasbarrini, The relationship of dehydroepiandrosterone sulfate (DHEAS) to endocrine-metabolic parameters and functional status in the oldest-old. Results from an Italian study on healthy free-living over-ninety-year-olds, J. Clin. Endocrinol. Metab. 81 (3) (1996 Mar) 1173-1178, https://doi.org/10.1210/ jcem.81.3.8772596.
[81] F. Bassi, A. Pupi, P. Giannotti, G. Fiorelli, G. Forti, A. Pinchera, M. Serio, Plasma dehydroepiandrosterone sulphate in hypothyroid premenopausal women, Clin.
Endocrinol 13 (1) (1980 Jul) 111-113, https://doi.org/10.1111/j.1365- 2265.1980.tb01031.x.
[82] J. Földes, T. Fehér, K.G. Fehér, E. Kollin, L. Bodrogi, Dehydroepiandrosterone sulphate (DS), dehydroepiandrosterone (D) and “free” dehydroepiandrosterone (FD) in the plasma of patients with thyroid diseases, Horm. Metab. Res. 15 (12) (1983 Dec) 623-624, https://doi.org/10.1055/s-2007-1018809.
[83] N. Tagawa, J. Tamanaka, A. Fujinami, Y. Kobayashi, T. Takano, S. Fukata, K. Kuma, H. Tada, N. Amino, Serum dehydroepiandrosterone, dehydroepiandrosterone sulfate, and pregnenolone sulfate concentrations in patients with hyperthyroidism and hypothyroidism, Clin. Chem. 46 (4) (2000 Apr) 523-528.
[84] S. Samanta, R. Mukherjee, N. Upadhyay, Alteration of serum dehydroepiandrosterone and its sulfated derivative in hypothyroidism, Int. J. Clin. Biochem. Res. 5 (4) (2018) 631-637, https://doi.org/10.18231/2394- 6377.2018.0134.
[85] F. Shao, R. Li, Q. Guo, R. Qin, W. Su, H. Yin, L. Tian, Plasma metabolomics reveals systemic metabolic alterations of subclinical and clinical hypothyroidism, J. Clin. Endocrinol. Metab. 108 (1) (2022 Dec 17) 13-25, https://doi.org/10.1210/ clinem/dgac555.
[86] N. Yamakita, T. Murai, Y. Kokubo, M. Hayashi, A. Akai, K. Yasuda, Dehydroepiandrosterone sulphate is increased and dehydroepiandrosterone- response to corticotrophin-releasing hormone is decreased in the hyperthyroid state compared with the euthyroid state, Clin. Endocrinol. 55 (6) (2001 Dec) 797-803, https://doi.org/10.1046/j.1365-2265.2001.01420.x.
[87] B.M. Arafah, Decreased levothyroxine requirement in women with hypothyroidism during androgen therapy for breast cancer, Ann. Intern. Med. 121 (4) (1994 Aug 15) 247-251, https://doi.org/10.7326/0003-4819-121-4-199408150-00002.
[88] J.A. Ahlquist, J.A. Franklyn, D.B. Ramsden, M.C. Sheppard, Regulation of alpha and thyrotrophin-beta subunit mRNA levels by androgens in the female rat, J. Mol. Endocrinol. 5 (1) (1990 Aug) 1-6, https://doi.org/10.1677/jme.0.0050001.
[89] I.E. Stoffers, M.C. de Vries, S.E. Hannema, Physical changes, laboratory parameters, and bone mineral density during testosterone treatment in adolescents with gender dysphoria, J. Sex. Med. 16 (9) (2019 Sep) 1459-1468, https://doi.org/ 10.1016/j.jsxm.2019.06.014.
[90] L.J. Tack, M. Craen, K. Dhondt, H. Vanden Bossche, J. Laridaen, M. Cools, Consecutive lynestrenol and cross-sex hormone treatment in biological female adolescents with gender dysphoria: a retrospective analysis, Biol. Sex. Differ. 7 (2016 Feb 16) 14, https://doi.org/10.1186/s13293-016-0067-9.
[91] R. Krysiak, W. Szkróbka, B. Okopień, Impact of dehydroepiandrosterone on thyroid autoimmunity and function in men with autoimmune hypothyroidism, Int. J. Clin. Pharm. 43 (4) (2021 Aug) 998-1005, https://doi.org/10.1007/s11096-020-01207- w.
[92] M.K. McIntosh, Berdanier CD. Influence of dehydroepiandrosterone (DHEA) on the thyroid hormone status of BHE/cdb rats, J. Nutr. Biochem. 3 (4) (1992 Apr) 194-199, https://doi.org/10.1016/0955-2863(92)90116-Z.
[93] T. du Toit, M. Groessl, E. Pignatti, A.C. Swart, C.E. Flück, Characterization of steroid metabolic 672 pathways in established human and mouse cell models, 673, Int J. Mol. Sci. 26 (19) (2025 Oct 6) 9721, https://doi.org/10.3390/ijms26199721.
[94] Y.H. Huang, C.Y. Lee, P.J. Tai, C.C. Yen, C.Y. Liao, W.J. Chen, C.J. Liao, W. L. Cheng, R.N. Chen, S.M. Wu, C.S. Wang, K.H. Lin, Indirect regulation of human dehydroepiandrosterone sulfotransferase family 1A member 2 by thyroid hormones, Endocrinology 147 (5) (2006 May) 2481-2489, https://doi.org/ 10.1210/en.2005-1166.
Glossary
11KA4: 11-ketoandrostenedione; metabolite of androstenedione with androgenic activity.
11KT: 11-ketotestosterone; potent androgen derived from testosterone.
110HA4: 11ß-hydroxyandrostenedione; hydroxylated androgen precursor with andro- genic activity.
11OHT: 11ß-hydroxytestosterone; hydroxylated metabolite of testosterone with andro- genic activity.
170HP5: 17-hydroxypregnenolone; intermediate in the 45 steroidogenic pathway.
21OHD: 21-hydroxylase deficiency; genetic enzyme defect causing cortisol/aldosterone deficiency and androgen excess.
A4: Androstenedione; androgen precursor.
ACTH: Adrenocorticotropic hormone; pituitary hormone that stimulates adrenal cortex steroidogenesis.
Adrenal Cortex: The outer layer of the adrenal gland, responsible for producing steroid hormones.
AKR1C3: Aldo-Keto Reductase Family 1 Member C3; also known as HSD17B5, catalyzes the conversion of androstenedione to testosterone.
CAH: Congenital adrenal hyperplasia; group of genetic disorders affecting adrenal steroid biosynthesis.
CYP11A1: Cytochrome P450 Family 11 Subfamily A Member 1; enzyme that catalyzes the conversion of cholesterol to pregnenolone.
CYP11B1: Cytochrome P450 Family 11 Subfamily B Member 1; enzyme involved in glucocorticoid and 11-oxygenated androgen synthesis.
CYP17A1: Cytochrome P450 Family 17 Subfamily A Member 1; enzyme with 17a-
hydroxylase and 17,20-lyase activity, critical for androgen production.
CYB5A: Cytochrome b5 type A; cofactor that enhances CYP17A1 17,20-lyase activity.
45 Pathway: A steroidogenesis pathway describing pregnenolone as precursor (as opposed to the 44 pathway starting with progesterone).
DHEA: Dehydroepiandrosterone; weak androgen and precursor to sex steroids. DHEAS: Dehydroepiandrosterone sulfate; the sulfated form of DHEA, and the most abundant circulating adrenal androgen.
DHT: Dihydrotestosterone; potent androgen derived from testosterone by SRD5A1 activity.
DIO1: Iodothyronine Deiodinase 1; enzyme converting T4 into T3.
DIO2: Iodothyronine Deiodinase 2; see DIO1.
FDX: Ferredoxin; component of the mitochondrial electron transport system in steroidogenesis.
FDXR: Ferredoxin reductase; electron donor partner of ferredoxin in mitochondrial steroidogenesis.
fT4: Free thyroxine (T4); the unbound, biologically active form of thyroxine.
FZ: Fetal zone; the inner zone of the fetal adrenal cortex that produces large amounts of DHEA and DHEAS.
GC: Glucocorticoid; steroid hormones involved in stress response, metabolism, and im- mune regulation.
H295A/R Cells: Human adrenocortical carcinoma cell lines used for studying adrenal steroidogenesis.
HPG: Hypothalamic-pituitary-gonadal axis; central neuroendocrine system regulating reproduction and development via sex hormone control
HPT: Hypothalamic-pituitary-thyroid axis; the regulatory system that controls thyroid hormone production.
HSD17B5: Hydroxysteroid (17-beta) dehydrogenase type 5; enzyme involved in the conversion of androstenedione to testosterone.
HSD3B1: 36-hydroxysteroid dehydrogenase type 1; murine HSD3B1, orthologous to human HSD3B2.
HSD3B2: 3ß-hydroxysteroid dehydrogenase type 2; enzyme that converts pregnenolone to progesterone and DHEA to androstenedione.
LC-MS: liquid chromatography-high resolution mass spectrometry; method to separate molecules for subsequent identification and quantification by mass.
MC: Mineralocorticoid; steroid hormones (e.g., aldosterone) that regulate salt and water balance.
P5: Pregnenolone; the first steroid produced from cholesterol in the steroidogenic pathway.
PA: Premature adrenarche; early onset of adrenal androgen production, before age 8 in girls and 9 in boys.
PAPSS2: 3’-phosphoadenosine 5’-phosphosulfate synthase 2; enzyme that generates the sulfate donor PAPS for DHEA sulfation.
PCOS: Polycystic Ovary Syndrome; endocrine disorder featuring hyperandrogenism and menstrual irregularities, often with polycystic ovaries.
POR: P450 oxidoreductase; electron donor for CYP17A1.
RAR: Retinoic acid receptor, nuclear receptor that heterodimerizes with other receptors, regulating gene expression.
RXR: Retinoid X receptor; see RAR.
SHH: Sonic Hedgehog; key player in adrenal zonation.
SM: Serum starvation medium; serum-free cell growth medium.
SRD5A1: Steroid 5a-reductase 1; enzyme that converts testosterone to dihydrotestosterone.
StAR: Steroidogenic acute regulatory protein; transports cholesterol into mitochondria, initiating steroidogenesis.
SULT2A1: Sulfotransferase family 2A member 1; enzyme responsible for sulfation of DHEA to form DHEAS.
T: Testosterone; the primary male sex hormone and anabolic steroid.
T3: 3,3’,5-triiodo-L-thyronine; the biologically active thyroid hormone.
T4: 3,3’,5,5’-tetraiodo-L-thyronine (thyroxine); thyroid hormone precursor of T3.
THRA: Thyroid hormone receptor alpha; nuclear receptor mediating thyroid hormone effects.
THRB: Thyroid hormone receptor beta; see THRA.
THs: Thyroid hormones; includes T3 and T4, which regulate metabolism, growth, and development.
Thyroidectomy: Surgical removal of the thyroid gland.
TRa1, TRØ1, TRØ2: Thyroid hormone receptor alpha, beta 1 and 2; isoforms of the thyroid hormone receptor alpha and beta, involved in gene regulation.
TRE: Thyroid response elements; DNA sequences on gene promoters recognized by thyroid hormone receptors.
TRH: Thyrotropin-Releasing Hormone; hypothalamic hormone stimulating pituitary TSH release to regulate the HPT axis.
TSH: Thyroid stimulating hormone; pituitary hormone that stimulates thyroid hormone synthesis and release.
WNT4: Wnt family member 4; signaling molecule involved in adrenal and gonadal development.
zF: Zona fasciculata; middle layer of the adrenal cortex that produces glucocorticoids.
zG: Zona glomerulosa; outermost layer of the adrenal cortex that produces mineralocorticoids.
zR: Zona reticularis; innermost layer of the adrenal cortex responsible for androgen production.