Potassium Channel Mutant KCNJ5 T158A Expression in HAC-15 Cells Increases Aldosterone Synthesis
Kenji Oki, Maria W. Plonczynski, Milay Luis Lam, Elise P. Gomez-Sanchez, and Celso E. Gomez-Sanchez
Research and Medical Service (K.O., M.W.P., M.L.L., E.P.G .- S., C.E.G .- S.), G.V. (Sonny) Montgomery Veterans Affairs Medical Center, Division of Endocrinology (K.O., M.W.P., M.L.L., E.P.G .- S., C.E.G .- S.), Department of Medicine, Department of Pharmacology (E.P.G .- S.), The University of Mississippi Medical Center, Jackson, Mississippi 39216
Primary aldosteronism is the most common cause of secondary hypertension, most frequently due to an aldosterone-producing adenoma or idiopathic hyperaldosteronism. Somatic mutations of the potassium channel KCNJ5 in the region of the selectivity filter have been found in a significant number of aldosterone-producing adenomas. There are also familial forms of primary aldoste- ronism, one of which, familial hyperaldosteronism type 3 which to date has been found in one family who presented with a severe abnormality in aldosterone and 18-oxocortisol production and hypertrophy and hyperplasia of the transitional zone of the adrenal cortex. In familial hyperal- dosteronism type 3, there is a genomic mutation causing a T158A change of amino acids within the selectivity filter region of the KCNJ5 gene.
We are reporting our studies demonstrating that lentiviral-mediated expression of a gene carrying the T158A mutation of the KCNJ5 in the HAC15 adrenal cortical carcinoma cell line causes a 5.3-fold increase in aldosterone secretion in unstimulated HAC15-KCNJ5 cells and that forskolin-stimulated aldosterone secretion was greater than that of angiotensin II. Expression of the mutated KCNJ5 gene decreases plasma membrane polarization, allowing sodium and calcium influx into the cells. The calcium channel antagonist nifedipine and the calmodulin inhibitor W-7 variably inhibited the effect. Overexpression of the mutated KCNJ5 channel resulted in a modest decrease in HAC15 cell proliferation.
These studies demonstrate that the T158A mutation of the KCNJ5 gene produces a marked stim- ulation in aldosterone biosynthesis that is dependent on membrane depolarization and sodium and calcium influx into the HAC15 adrenal cortical carcinoma cells. (Endocrinology 153: 1774-1782, 2012)
P rimary aldosteronism (PA) is characterized by the au- tonomous excessive production of aldosterone from the adrenal zona glomerulosa (1). Patients with PA are hypertensive and have a high prevalence of cardiovascular and cerebrovascular complications (1, 2). PA is the most frequent cause of the secondary hypertension with a fre- quency of 5-10% among hypertensives (1). The two most common forms of PA are aldosterone-producing adeno- mas (APA) and idiopathic hyperaldosteronism, also called
bilateral adrenal zona glomerulosa hyperplasia (1, 3). Some forms of PA are familial, including familial primary aldosteronism type I or glucocorticoid-suppressible aldo- steronism, due to a gene duplication produced by the un- even recombination between the 5’-regulatory segments of the cytochrome P450 (CYP)11B1 gene (exons 2-4) and the last exons of the CYP11B2 gene, resulting in a hybrid aldosterone synthase gene that is regulated by ACTH (4, 5). These patients excrete large quantities of the hybrid
Copyright @ 2012 by The Endocrine Society
Abbreviations: A-II, Angiotensin II; APA, aldosterone-producing adenoma; CaMK, calm- odulin-dependent protein kinase; CYP, cytochrome P450; FH3, familial hyperaldosteron- ism type 3; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GYG, glycine-tyrosine- glycine; PA, primary aldosteronism; STAR, steroidogenic acute regulatory protein; XTT, 2,3-Bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide inner salt.
steroids 18-hydroxycortisol and 18-oxocortisol in addi- tion to aldosterone (6). Familial hyperaldosteronism type 2 is the most common familial form, but it is of unknown etiology with a linkage to chromosome 7p22 in some fam- ilies (7). In familial hyperaldosteronism type 3 (FH3), of which only one family has been reported to date, patients have severe hypertension and the highest recorded excre- tion of the hybrid steroids 18-hydroxycortisol and 18- oxocortisol (8).
The resting membrane potential of the zona glomeru- losa cell is regulated by potassium (K+) channel activity (9). Voltage-gated calcium (Ca2+) channels are activated by membrane depolarization by hyperkalemia and by an- giotensin II (A-II). The resulting increase in intracellular Ca2+ initiates the signaling events that increase aldoste- rone biosynthesis (9). The etiology of APA or idiopathic hyperaldosteronism is unknown. Recently, Choi et al. (10) reported the presence either of two somatic mutations of the KCNJ5 gene coding for the potassium channel Kir3.4 in eight of 22 aldosterone-producing adenomas, as well as in the FH3 family. The mechanisms by which a KCNJ5 mutation causes increased aldosterone production in ad- renal zona glomerulosa cells have not been fully eluci- dated, although the KCNJ5 mutations, G151R or L168R, found in the APA tumors were in or near the selectivity filter in the glycine-tyrosine-glycine (GYG) motif of the Kir3.4 protein (10). The family with FH3 has an inherited mutation, T158A, within the same region associated with severe hyperaldosteronism and massive bilateral adrenal cortical hyperplasia with transitional zone characteristics (8, 10).
K+ selectivity of KCNJ potassium channel is conferred by a GYG motif at the narrowest part of the pore. Inflow of K+ through the channel hyperpolarizes the cell mem- brane (11). The mutation around the GYG motif in the APA and FH3 patients was shown to alter selectivity for cations including Na+, thereby depolarizing the cell mem- brane (12), triggering the opening of the voltage-gated Ca2+ channel (13), resulting in an influx of Ca2+ into the cell that activates sequential cascades including calmod- ulin and calmodulin kinase, and leading to increased ste- roidogenesis in adrenal cortical cells (14).
In this study, we hypothesized that expression in the adrenocortical carcinoma cell line HAC15 (15) using a lentivirus carrying a Kir 3.4 mutation (T158A) would in- crease aldosterone secretion and provide a model with which to address the mechanism of action of KCNJ5 in adrenal zona glomerulosa cells.
Materials and Methods
Cell culture and materials
The HAC15 human adrenocortical carcinoma cell line, a sub- clone of the H295R, a human adrenocortical carcinoma cell (15,
16), was provided by W. E. Rainey (Georgia Health Care Uni- versity). The HAC15 cells were cultured in DMEM-F12 (1:1) supplemented with 10% Cosmic Calf serum (HyClone Labora- tories, Logan, UT) at 37C under an atmosphere of 5% CO2.
A-II and nifedipine were purchased from Sigma Aldrich Co. Ltd. (St. Louis, MO). Forskolin was from LC Laboratories (Woburn, MA), and W-7, an inhibitor of calmodulin, was from Merck KGaA (Darmstadt, Germany). G418 and Blasti- cidin used to select lentiviral infected cells were purchased from InvivoGen (San Diego, CA). The dye to detect membrane voltage, DiSBAC2 (3), was purchased from AnaSpec (Fre- mont, CA); those to detect Na+ inflow, CoroNa Green, and intracellular Ca2+ concentration, Fluo-4 AM, were purchased from Invitrogen (Carlsbad, CA).
Plasmids
The full-length cDNA of KCNJ5 (pCR4-TOPO) was purchased from Open Biosystems (Huntsville, AL). The KCNJ5 mutation (T158A) plasmid was made using the QuikChange II XL Site Di- rected Mutagenesis kit from Stratagene (Santa Clara, CA) and the following primers: forward, GGCTTCCGAGTCATCGCA- GAGAAGTGTCCAG; reverse, CTGGACACTTCTCTGCGAT- GACTCGGAAGCC. The cDNA was then amplified by PCR using the 5’-primer CACCGCTATGGCTGGCGATTCTAGGAA and 3’-primer TTATCACACCGAGCCCCTGGCC and inserted into pENTR/D-TOPO for subsequent use in LR reactions with the Gate- way-compatible lentivector pLX303 plasmid (Addgene plasmid 25897; Addgene, Cambridge MA) (17) by LR reaction method (Invitrogen), resulting in pLX303-KCNJ5 T158A. Control plasmid was prepared as pLX303 without KCNJ5. The sequence of the mutation was confirmed by a PCR-based direct sequencing method.
The lentiviral transfer plasmid pBM14 was obtained from Dr. Fusseneger (18). Its promoter was eliminated by amplifying the plasmid using primers that excluded the EF1 promoter and in- troducing a restriction site. The 5’-flanking DNA of CYP11B2 (-1521 bp) from a pGL3 plasmid (a kind gift from Dr W. Rainey) was fused immediately upstream of the gaussia lu- ciferase cDNA resulting in pBM14-CYP11B2 promoter/gaussia. The psPAX2 (Addgene plasmid 12260 from Didier Trono’s Lab- oratory), and pCMV-VSV-G (Addgene plasmid 8454 from the Stewart laboratory (19) for virus production were purchased from Addgene, Inc.
Lentiviral production and infection
The 293TN cell line (System Biosciences, Mountain View, CA) was cultured in branched PEI25-coated plates (Sigma Al- drich) with DMEM supplemented with FetalClone II serum (Hy- Clone Laboratories, Logan, UT) until 80-90% confluent, and then transfected with lentiviral transfer vector, psPAX2, and pCMV-VSV-G (0.41 µg/cm2; 12:14:8 molar ratio) using PEI22 (20). Medium was replaced after an overnight incubation, after which cells were cultured for an additional 48 h. Supernatant collected from this cell culture was centrifuged at 3000 × g for 30 min at 4C and stored at -80C.
Transduction with control or KCNJ5-T158A lentivirus was performed 24 h after seeding HAC15 (21, 22). To assess steroid production, membrane voltage, mRNA expression, and intra- cellular Ca2+ concentration 72 h after infection, cells were serum deprived using DMEM-F12 supplemented with 0.1% cosmic
calf serum for 24 h. The medium was replaced with fresh DMEM-F12 containing 0.1% cosmic calf serum with or without 10 nM A-II, 10 µM forskolin, 3 or 10 µM nifedipine, or 10 or 30 ALM W-7. Cells were incubated for 18 h, after which the super- natants were collected for steroid measurement and the cells were harvested for analysis of mRNA and protein expression.
To investigate the effect of KCNJ5-T158A on cell proliferation and apoptosis assay, HAC15 cells were stably infected with control or KCNJ5-T158A lentivirus as previously described (23). Briefly, 72 h after infection, the cells were selected with 5 µg/ml of blasti- cidin. The cells were cultured for at least 4 wk in the absence of the selecting agent before performing the experiments to avoid any con- founding effect due to the selecting antibiotic.
Luciferase assay
To assess the CYP11B2 activity, we transduced HAC15 cells with lentivirus carrying the pBM14-CYP11B2 promoter/gaussia luciferase as above, using G418 (0.5 mg/ml) for antibiotic selec- tion. The stably transduced cells were plated in 48-well plates and then transduced with control or KCNJ5-T158A lentivirus. The supernatants were collected and placed in 96-well plates for luminescence detection using the gaussia luciferase substrate coelenterazine (Gold Biotechnology, St. Louis, MO), and read with a BMG FLUOstar Omega Reader (BMG Labtech, Orten- berg, Germany) (24).
RNA extraction and RT-PCR
Total RNA was extracted with the RNAzol-RT Reagent (Molecular Research Center, Inc., Cincinnati, OH). For re- verse transcription, 1.5 µg of total RNA was incubated with SUPERase-In (Applied Biosystems/Ambion, Austin, TX) or SuperScript III (Invitrogen) following the manufacturer’s pro- tocol. Table 1 shows real-time PCR primers designed to generate approximately 100-bp amplicons. CYP11B2, CYP11B1, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression were determined by the Taqman Gene expression assay as previously reported (21). mRNA expression of steroid- ogenic acute regulatory protein (STAR), cytochrome P450, fam- ily 11, subfamily A, polypeptide 1 (CYP11A1), 3ß-hydroxys- teroid dehydrogenase, cytochrome P450, family 21, subfamily A, polypeptide 2 (CYP21A2), cytochrome P450, family 17, sub- family A, polypeptide 1 (CYP17A1) and GAPDH were quanti- fied with 1 ul reverse transcription product, 1 ul Titanium Taq DNA polymerase (CLONTECH Laboratories, Inc., Mountain View, CA), 1:20000 dilution SYBR Green I (Molecular Probes, Carlsbad, CA), 10 nM (Bio-Rad Laboratories, Hercules, CA), 0.2 mM deoxynucleotide triphosphates, and 0.1 µM each primer. Real-time data were obtained during the extension phase, and
critical threshold cycle values were calculated at the log phase of each gene amplification curve. Gene expression levels were an- alyzed as arbitrary units normalized against GAPDH mRNA expression.
Cell proliferation and apoptosis assay
The 2,3-Bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazo- lium-5-carboxanilide inner salt (XTT) cell proliferation assay kit (American Type Culture Collection, Manassas, VA) was used to evaluate the effect of KCNJ5-T158A on cell proliferation (25). Briefly, the stably transduced control and KCNJ5-T158A cells were seeded on 96-well plates at a concentration of 5 × 104 cells per well and incubated with 50 ul of activated-XTT solution for 4 h, following the manufacture’s protocol. The absorbance of the wells was measured at a wavelength of 475 nm and 660 nm.
For crystal violet staining, the stably transduced cells were plated at 1 × 105 cells per well in 48-well plates, the supernatant was aspirated at the indicated times, and the cells were fixed for 20 min in 10% paraformaldehyde. They were then stained for 30 min with a 0.05% solution of crystal violet, washed with water, then solubilized in 1% sodium dodecyl sulfate solution for 1 h, and absorbance was read at 590-nm wavelength.
The commercial Caspase-3/CPP32 detection kit (InvivoGen) was used to investigate the effect of KCNJ5-T158A on the ap- optotic state. The stably transduced cells were plated at 1 × 106 cells per well in 12-well plates, and cells were harvested and incubated following the manufacturer’s instruction.
Analysis of inflow of Na+ into cytoplasm, plasma membrane voltage, and intracellular Ca2+ concentration
After transduction with control or KCNJ5-T158A lentiviruses and serum starving as above, the medium was replaced with fresh DMEM-F12 containing 0.1% cosmic calf serum with 10 AM Co- roNa Green dye to assess Na+ flow into cytoplasm, 3 ULM DiSBAC2 for membrane voltage, or 3 AM Fluo-4 AM for intracellular Ca2+ concentration. After incubation for the indicated times, the cells were washed three times with HEPES buffer, and fluorescence was detected with a BMG FLUOstar Omega Reader.
Steroid and protein assays
Aldosterone, cortisol, and 18-oxocortisol levels were mea- sured in cell culture supernatants by time-resolved fluorescence. The primary antibodies were developed in our laboratory as previously described (26, 27). The protein levels were detected by ELISA using a Micro BCA Protein Assay kit (Thermo Scientific, Rockford, IL).
| Gene symbol | Forward primer | Reverse primer |
|---|---|---|
| STAR | CATACTCTAAACACGAACCCCACC | GTCCCACCCTGCCTCTGAAG |
| CYP11A1 | CTTCTTCGACCCGGAAAATTT | CCGGAAGTAGGTGATGTTCTTGT |
| HSD3B2 | AGAAGAGCCTCTGGAAAACACATG | TAACGCACAAGTGTACAAGGTATCACCA |
| CYP21A2 | TCCCAGCACTCAACCAACCT | CAGCTCAGAATTAAGCCTCAATCC |
| CYP17A1 | AGCCGCACACCAACTATCAG | TCACCGATGCTGGAGTCAAC |
| CYP11B1 | GGCAGAGGCAGAGATGCTG | TCTTGGGTTAGTGTCTCCACCTG |
| CYP11B2 | GGCAGAGGCAGAGATGCTG | CTTGAGTTAGTGTCTCCACCAGGA |
| GAPDH | CCCCTTCATTGACCTCAACTAC | GATGACAAGCTTCCCGTTCTC |
Statistical analysis
All results were expressed as mean ± SE of at least three sep- arate experiments in which each sample was assayed in triplicate or quadruplicate. Differences between two groups were analyzed for statistical significance by t test and multiple groups were analyzed by one-way ANOVA followed by Bonferroni compar- isons. The differences were considered to be significant at P < 0.05. Analyses were performed using SPSS for Windows (release 12.0; SPSS Inc., Chicago, IL).
Results
The effects of KCNJ5-T158A on aldosterone production
The sequence of the KCNJ5-T158A plasmid was confirmed by a direct sequence method. Transduction of HAC15 cells with the lentivirus carrying the KCNJ5- T158A mutation potentiated basal aldosterone produc- tion 5.3-fold over empty lentivirus-infected HAC15 control cells (Fig. 1A). Cells transduced with the wild KCNJ5 lentivirus decreased aldosterone production and were not used as controls in these experiments (data not shown). To compare the effects of KCNJ5-T158A on aldosterone production induced by A-II and forsko- lin, we measured aldosterone levels in the supernatants of control and KCNJ5-T158A cells stimulated by A-II and forskolin. There was no difference in the level of aldosterone stimulation between A-II and forskolin in control cells, but aldosterone secretion stimulated by forskolin was significantly greater than by A-II in KCNJ5-T158A cells (Fig. 1A). Cortisol production was only slightly, but significantly, stimulated by KCNJ5- T158A (Fig. 1B). KCNJ5-T158A-infected cells also showed enhanced 18-oxocortisol production compared with control HAC15 cells (Fig 1C).
The alteration of extracellular Na+ inflow into cytoplasm, membrane voltage, and intracellular Ca2+ concentration by the KCNJ5-T158A mutation in HAC15 cells
To elucidate the mechanism of the effect of the KCNJ5- T158A mutation on aldosterone production, we first in- vestigated its effect on Na + influx in the HAC15 cells using a cell-impermeant dye, CoroNa Green. KCNJ5-T158A cells had a 1.2-fold higher fluorescence for Na+ than con- trol cells, indicating that Na+ inflow was increased by the mutation (Fig. 2A). KCNJ5-T158A cells showed a 2.3- fold increased accumulation of DiSBAC2 (3), an indicator of higher plasma membrane voltage than control cells (Fig. 2B). As shown in Fig. 2C, KCNJ5-T158A caused a 1.6- fold increase in Fluo-4 AM, an indicator of intracellular
A
+
Aldosterone levels (- fold increase)
10.0
*
8.0
*
6.0
*
Z
I
4.0
2.0
0
control
KCNJ5
T158A
control
KCNJ5 T158A
control KCNJ5
T158A
Basal
A-II 10nM
Forskoline 10 / M
B
3.0
*
*
I
Cortisol levels (- fold increase)
2.5
I
2.0
*
1.5
₮
1.0
0.5
0
control
KCNJ5
T158A
control
KCNJ5
T158A
control KCNJ5
T158A
Basal
A-II 10nM
Forskoline 10 / M
C
18-oxocortisol levels (- fold increase)
10.0
*
8.0
I
*
6.0
I
4.0
*
1
2.0
0
control
KCNJ5
T158A
control
KCNJ5
T158A
control KCNJ5 T158A
Basal
A-II 10nM
Forskoline 10 / M
Ca2+ concentration, compared with control. These results suggested that the KCNJ5-T158A mutation led to a se- quential increase in Na influx, membrane voltage, and intracellular Ca2+ accumulation.
mRNA expression and reporter assay of steroid biosynthetic enzymes
The expression of CYP11B1 and CYP11B2 mRNA in KCNJ5-T158A cells was significantly elevated by 5.8-fold and 17.7-fold in comparison to control cells, respectively (Fig. 3). However, no differences of other steroidogenic enzymes or StAR were observed between control and KCNJ5-T158A cells (Fig. 3), except for CYP17A1, which was significantly decreased.
We investigated the transcriptional regulation of CYP11B2 analyzed by luciferase assays using HAC15
A
for Na+ inflow into cytoplasm (- fold increase)
1.5
*
CoroNa Green
*
1.0
0.5
0
control
KCNJ5-T158A
B
for membrane voltage (- fold increase)
3.0
* *
DISBAC2(3)
1
2.0
1.0
0
control
KCNJ5-T158A
C
for intracellular Ca (- fold increase)
2.0
*
Fluo-4 AM
1.0
0
control
KCNJ5-T158A
cells stably infected with each reporter construct. As shown in Fig. 4, CYP11B2 transcriptional activity in KCNJ5-T158A cells showed 2.8-fold increase compared with that in control cells.
**
20.0
Steroidogenic factors mRNA expression
15.0
control
KCNJ5
(- fold increase)
T158A
* *
6.0
4.0
2.0
1.0
*
I
0
STAR
CYP11A1
HSD3B2
CYP21A2
1 CYP11B1
CYP11B2
CYP11B2 promoter assay (- fold increase)
3.5
*
3.0
2.5
2.0
1.5
1.0
0.5
0
control
KCNJ5
T158A
Calcium channels and calmodulin mediate the aldosterone production in KCNJ5-T158A cells
To determine the role of increased intracellular Ca2+ in aldosterone production in KCNJ5-T158A cells, aldoste- rone levels in the supernatant of KCNJ5-T158A cells treated with or without 3 or 10 AM nifedipine or 10 or 30 MLM W-7 was measured. Nifedipine (10 µM) and W-7 (30 M) showed 75% and 18% inhibition of aldosterone pro- duction, respectively (Fig. 5A). Nifedipine (10 µM) and W-7 (30 MM) also inhibited CYP11B2 reporter activity by 46% and 20%, respectively (Fig. 5B). These results indi- cated that increased intracellular Ca2+ has a role in the regulation of aldosterone production in KCNJ5-T158A cells.
Effects of KCNJ5-T158A on adrenal cell proliferation
Proliferation of cells transduced with KCNJ5-T158A lentivirus was significantly less than that of control cells as detected by crystal violet staining (25.2% reduction) and XTT assay (31.8% reduction) after 72 h incubation (Fig. 6, A and B). Cells transduced with wild KCNJ5 lentivirus had no effect on proliferation (data not shown). We per- formed an apoptosis assay using Caspase-3 protein mea- surement, because the protein is reported to be regulated in human adrenal cells for apoptosis (28). No difference of Caspase-3 protein levels between control and KCNJ5- T158A cells (1.07 + 0.07-fold increase) was found. Next, to know whether the negative effect of KCNJ5-T158A on cell proliferation was mediated by intracellular Ca2+ con- centration, we investigated the effects of nifedipine on cell proliferation in control and KCNJ5-T158A cells. Nifed- ipine caused a 22.7% and 33.0% reduction of cell prolif-
A
control
KCNJ5-T158A
6.0
Aldosterone levels (-fold increase)
5.0
*
**
4.0
T
3.0
**
* *
2.0
1.0
x
0
inhibitor
3 μ Μ 10 μM 10μM 30 μ M
-
-
Nifedipine
W-7
B
CYP11B2 promoter assay (-fold increase)
4.0
control
KCNJ5-T158A
3.0
**
**
2.0
**
**
T
I
I
1.0
I
0
inhibitor
3μ Μ 10 μM
10 μ M
30 μ. Μ
-
-
Nifedipine
W-7
eration by crystal violet staining and XTT assay in control cells, respectively (Fig. 6, A and B). KCNJ5-T158A cells were further negatively regulated with nifedipine treat- ment as detected by crystal violet staining (24.2% reduc- tion) and XTT assay (21.0% reduction), compared with control cells with nifedipine (Fig. 6, A and B). Therefore, nifedipine does not influence the difference of cell prolif- eration between control and KCNJ5-T158A cells, indi- cating that the effect of cell proliferation is independent of intracellular calcium concentration.
Discussion
Certain mutations around the GYG motif in KCNJ5 cause a loss in K+ selectivity and an increase in Na+ influx into cytoplasm (12), resulting in the depolarization of the plasma membrane, thereby activating the voltage-gated Ca2+ channel, and accumulation of intracellular Ca2+.
A
1.5
Crystal violet staining (- fold increase)
1.0
*
*
+
1
I
*
0.5
0
control
KCNJ5
T158A
control
KCNJ5
T158A
none
Nifedipine 10 μ M
B
1.5
XTT assay (- fold increase)
1.0
I
*
*
+
I
*
0.5
I
0
control
KCNJ5
KCNJ5
T158A
control
T158A
none
Nifedipine 10 μ M
We showed that KCNJ5-T158A-transduced adrenocorti- cal cells had a greater influx of Na+ into cytoplasm, in- creased intracellular Ca2+ concentration, and higher membrane voltage. Increased intracellular Ca2+ activates calmodulin-dependent kinase (CaMK) I and subsequent regulation of gene transcription, resulting in the synthesis of steroidogenic enzymes and increased aldosterone pro- duction (14). mRNA expression and transcriptional ac- tivity of CYP11B2 were up-regulated in KCNJ5-T158A cells, resulting in the increase in aldosterone production. Because the Ca2+ channel blocker and calmodulin antag- onist suppressed the CYP11B2 transcriptional activity and aldosterone production in KCNJ5-T158A cells, the increased CYP11B2 expression in these cells appears to be mediated by the Ca2+/calmodulin cascade. Whereas transduction of HAC15 cells with KCNJ5-T158A lenti- viruses stimulated aldosterone production, cell prolifera- tion was inhibited, consistent with published results show- ing that increased intracellular Ca2+ negatively regulates cell proliferation (29, 30).
The KCNJ5-T158 corresponds to the chicken KCNJ12- T152, which is highly conserved among species and identical to other inward-rectifier K+ channels (10, 31). The crystal structure of chicken KCNJ12 (Kir2.2), the only one available
for the inward-rectifier K+ channels, shows that the pore helix and selectivity filter is 89% identical to the human KCNJ5 (31). The KCNJ5-T158 is near the GYG motif in the pore and makes hydrogen bonds with conserved po- sitions P128 and C129 to maintain pore function (10). Mutations near GYG motif change the plasma membrane voltage by altering K+ selectivity (12). Therefore, disrup- tion of hydrogen binding by the KCNJ5-T158A mutation could alter pore morphology, resulting in loss of K+ se- lectivity (10). Our results show that there is an increase in Na+ inflow in cells transduced with the KCNJ5-T158A lentiviruses and support this explanation.
Other potassium channels participate in aldosterone regulation. TWIK-related acid-sensitive K TASK-1 and TASK-3 subunits, of the KCNK family of two-pore do- main/four-transmembrane K channels, regulate the recti- fication properties in physiological asymmetric K+ solu- tions. TASK 1 subunit-knockout mice and TASK 1 + 3 double-knockout mice exhibited depolarized membrane voltage in the adrenal cortex and activation of voltage- dependent Ca2+ channel, producing aldosterone hyper- secretion (32, 33). Aldosterone synthase expression is nor- mally restricted to the adrenal zona glomerulosa cell. TASK 1-knockout mice exhibited a gender-specific alter- ation in adrenal aldosterone synthesis characterized by expression of the aldosterone synthase in the zona fas- ciculata of female mice, which was glucocorticoid sup- pressible (32). The large Ca2+-activated K+ (BK) channel mediates steady hyperpolarization as a result of transient outward currents carried by BK channels, which were spontaneously activated by the local release of Ca2+ from intracellular stores (34). Recent studies show that aldo- sterone concentration in blood is elevated in both BK-a- and BK-ß1-knockout mice (35).
Calmodulin is highly expressed in the adrenal cortex (36), and the increase in intracellular Ca2+ by voltage- gated receptors activates calmodulin, which activates CaMK I and stimulates aldosterone production (14). We observed that the increase of membrane voltage by the KCNJ5 mutation enhanced the intracellular Ca2+ con- centration and increased in CYP11B2 mRNA expression and aldosterone production. Calcium channel and cal- modulin antagonists suppressed these increases in the mu- tant cells.
The steroid production profile of HAC15 transduced with KCNJ5-T158A lentiviruses was comparable to that of patients with aldosterone-producing adenomas and FH3 (8, 10). H295R, the parent cell line of the HAC15 cell, and the HAC15 cell do not respond or respond poorly to ACTH but respond well to the PKA activator forskolin (15, 37). As shown in Fig 1A, the response to forskolin was more prominent than that to A-II. Aldosterone-producing
adenomas respond better to ACTH than to A-II (38-40). Our in vitro findings regarding enhancement of the Ca2+/ calmodulin-related cascade are consistent with recent ev- idence showing that APA have activated Ca2+/CaMK pathways (41), and a microarray study indicated that the CaMK-dependent pathways are enhanced in a subset of the APA (42). Patients with APA synthesize significant quantities of the hybrid steroid 18-oxocortisol (43, 44), and patients with FH3 produce massive amounts of 18- oxocortisol (8). Consistent with the in vivo findings in pa- tients with FH3, compared with control cells, the HAC15- KCNJ5-T158A cells produced significantly greater amounts of 18-oxocortisol, as well as aldosterone, under basal con- ditions, and synthesis was further enhanced by stimula- tion. In the family with FH3, the very high production of aldosterone and 18-oxocortisol in FH3 was not suppress- ible with dexamethasone, probably reflecting the marked increase in cells with transitional zone charac- teristics (8). The KCNJ5-T158A mutation has only been found in FH3, although the KCNJ5-G151R and G168R mutations found in some APA adenomas are in the same selectivity region of the KCNJ5 potassium channel, thus would be expected to show similar characteristics with respect to basal and stimulated alterations in aldoste- rone secretion (10).
Aldosterone-producing adenomas are generally small, but in the initial report of patients with the somatic mu- tations in KCNJ5, the tumors were relatively large (8). Activation of Ca2+ signaling inhibits growth in the G2 phase of the cell cycle in mammalian cell lines and budding yeast (29). Expression of a constitutive form of calcium/ CaMK II leads to the arrest of the cell cycle in G2 (30). Similarly, colon cancer appears to be inhibited by the in- crease in intracellular Ca2+ concentration in clinical and experimental studies (45, 46). In FH3, characterized by the genomic KCNJ5-T158A mutation, there is atrophy or suppression of zona glomerulosa and marked hyperplasia and cellular hypertrophy of an area characteristic of the transitional zone and/or zona fasciculata (8). The discrep- ancy between the cell-specific hyperplasia and hypertro- phy in FH3 adrenals and the decreased proliferation of HAC15-KCNJ5-T158A cells might be due to the fact that the HAC15 cells were derived from an adrenal carcinoma, which might differ from in vivo development of an ade- noma (47).
In conclusion, we have demonstrated the mechanism of increased aldosterone synthesis produced by a mutation near the GYG motif in the selectivity filter of the potassium channel that mediates inward rectifying currents. HAC15 infected with a KCNJ5-T158A lentivirus carrying a mu- tation near the GYG motif in the selectivity filter results in decreased ion selectivity of the channel, membrane depo-
larization, activation of voltage-gated Ca2+ channels, in- creased intracellular Ca2+ concentration, CYP11B2 over- expression, and increased aldosterone and 18-oxocortisol production.
Acknowledgments
Address all correspondence and requests for reprints to: Celso E. Gomez-Sanchez, M.D., G.V. (Sonny) Montgomery Veterans Af- fairs Medical Center, 1500 East Woodrow Wilson Drive, Jack- son, Mississippi 39216. E-mail: cgomez-sanchez@umc.edu.
This work was supported by National Institutes of Health grants HL27255 and HL105383 and from medical research funds from the Department of Veterans Affairs.
Disclosure Summary: K.O., M.W.P., M.L.L., E.P.G .- S., and C.E.G .- S. have nothing to declare.
References
1. Funder JW, Carey RM, Fardella C, Gomez-Sanchez CE, Mantero F, Stowasser M, Young Jr WF, Montori VM 2008 Case detection, diagnosis, and treatment of patients with primary aldosteronism: an endocrine society clinical practice guideline. J Clin Endocrinol Metab 93:3266-3281
2. Milliez P, Girerd X, Plouin PF, Blacher J, Safar ME, Mourad JJ 2005 Evidence for an increased rate of cardiovascular events in patients with primary aldosteronism. J Am Coll Cardiol 45:1243-1248
3. Mulatero P, Bertello C, Rossato D, Mengozzi G, Milan A, Garrone C, Giraudo G, Passarino G, Garabello D, Verhovez A, Rabbia F, Veglio F 2008 Roles of clinical criteria, computed tomography scan, and adrenal vein sampling in differential diagnosis of primary al- dosteronism subtypes. J Clin Endocrinol Metab 93:1366-1371
4. Lifton RP, Dluhy RG, Powers M, Rich GM, Gutkin M, Fallo F, Gill Jr JR, Feld L, Ganguly A, Laidlaw JC, Murnaghan DJ, Kauffman C, Stockigt J, Ulick l, Lalouel J-M 1992 Hereditary hypertension caused by chimeric gene duplication and ectopic expression of al- dosterone synthase. Nat Genet 2:66-74
5. Pascoe L, Curnow KM, Slutsker L, Connell JM, Speiser PW, New MI, White PC 1992 Glucocorticoid-suppressible hyperaldosteron- ism results from hybrid genes created by unequal crossovers between CYP11B1 and CYP11B2. Proc Natl Acad Sci USA 89:8327-8331
6. Gomez-Sanchez CE, Gill Jr JR, Ganguly A, Gordon RD 1988 Glu- cocorticoid-suppressible aldosteronism: a disorder of the adrenal transitional zone. J Clin Endocrinol Metab 67:444-448
7. Sukor N, Mulatero P, Gordon RD, So A, Duffy D, Bertello C, Kele- men L, Jeske Y, Veglio F, Stowasser M 2008 Further evidence for linkage of familial hyperaldosteronism type II at chromosome 7p22 in Italian as well as Australian and South American families. J Hy- pertens 26:1577-1582
8. Geller DS, Zhang J, Wisgerhof MV, Shackleton C, Kashgarian M, Lifton RP 2008 A novel form of human mendelian hypertension featuring nonglucocorticoid-remediable aldosteronism. J Clin En- docrinol Metab 93:3117-3123
9. Spät A, Hunyady L 2004 Control of aldosterone secretion: a model for convergence in cellular signaling pathways. Physiol Rev 84:489- 539
10. Choi M, Scholl UI, Yue P, Björklund P, Zhao B, Nelson-Williams C, Ji W, Cho Y, Patel A, Men CJ, Lolis E, Wisgerhof MV, Geller DS, Mane S, Hellman P, Westin G, Åkerström G, Wang W, Carling T, Lifton RP 2011 K+ channel mutations in adrenal aldosterone-pro-
ducing adenomas and hereditary hypertension. Science 331:768- 772
11. Heginbotham L, Abramson T, Mackinnon R 1992 A functional connection between the pores of distantly related ion channels as revealed by mutant K+ channels. Science 258:1152-1155
12. Dibb KM, Rose T, Makary SY, Claydon TW, Enkvetchakul D, Leach R, Nichols CG, Boyett MR 2003 Molecular basis of ion se- lectivity, block, and rectification of the inward rectifier Kir3.1/ Kir3.4 K(+) channel. J Biol Chem 278:49537-49548
13. Yao J, Davies LA, Howard JD, Adney SK, Welsby PJ, Howell N, Carey RM, Colbran RJ, Barrett PQ 2006 Molecular basis for the modulation of native T-type Ca2+ channels in vivo by Ca2+/cal- modulin-dependent protein kinase II. J Clin Invest 116:2403-2412
14. Condon JC, Pezzi V, Drummond BM, Yin S, Rainey WE 2002 Calm- odulin-dependent kinase I regulates adrenal cell expression of aldo- sterone synthase. Endocrinology 143:3651-3657
15. Parmar J, Key RE, Rainey WE 2008 Development of an adrenocor- ticotropin-responsive human adrenocortical carcinoma cell line. J Clin Endocrinol Metab 93:4542-4546
16. Wang T, Rainey WE 5 September 2011 Human adrenocortical car- cinoma cell lines. Mol Cell Endocrinol 10.1016/j.mce.2011.08.041
17. Yang X, Boehm JS, Yang X, Salehi-Ashtiani K, Hao T, Shen Y, Lubonja R, Thomas SR, Alkan O, Bhimdi T, Green TM, Johan- nessen CM, Silver SJ, Nguyen C, Murray RR, Hieronymus H, Bal- cha D, Fan C, Lin C, Ghamsari L, Vidal M, Hahn WC, Hill DE, Root DE 2011 A public genome-scale lentiviral expression library of hu- man ORFs. Nat Methods 8:659-661
18. Mitta B, Rimann M, Ehrengruber MU, Ehrbar M, Djonov V, Kelm J, Fussenegger M 2002 Advanced modular self-inactivating lentivi- ral expression vectors for multigene interventions in mammalian cells and in vivo transduction. Nucleic Acids Res 30:e113
19. Stewart SA, Dykxhoorn DM, Palliser D, Mizuno H, Yu EY, An DS, Sabatini DM, Chen IS, Hahn WC, Sharp PA, Weinberg RA, Novina CD 2003 Lentivirus-delivered stable gene silencing by RNAi in pri- mary cells. RNA 9:493-501
20. Thomas M, Lu JJ, Ge Q, Zhang C, Chen J, Klibanov AM 2005 Full deacylation of polyethylenimine dramatically boosts its gene deliv- ery efficiency and specificity to mouse lung. Proc Natl Acad Sci USA 102:5679-5684
21. Romero DG, Gomez-Sanchez EP, Gomez-Sanchez CE 2010 Angio- tensin II-regulated transcription regulatory genes in adrenal steroid- ogenesis. Physiol Genomics 42A:259-266
22. Romero DG, Plonczynski MW, Welsh BL, Gomez-Sanchez CE, Zhou MY, Gomez-Sanchez EP 2007 Gene expression profile in rat adrenal zona glomerulosa cells stimulated with aldosterone secre- tagogues. Physiol Genomics 32:117-127
23. Romero DG, Zhou MY, Yanes LL, Plonczynski MW, Washington TR, Gomez-Sanchez CE, Gomez-Sanchez EP 2007 Regulators of G-protein signaling 4 in adrenal gland: localization, regulation, and role in aldosterone secretion. J Endocrinol 194:429-440
24. Tannous BA 2009 Gaussia luciferase reporter assay for monitoring biological processes in culture and in vivo. Nat Protoc 4:582-591
25. Berridge MV, Herst PM, Tan AS 2005 Tetrazolium dyes as tools in cell biology: new insights into their cellular reduction. Biotechnol Annu Rev 11:127-152
26. Gomez-Sanchez CE, Foecking MF, Ferris MW, Chavarri MR, Uribe L, Gomez-Sanchez EP 1987 The production of monoclonal anti- bodies against aldosterone. Steroids 49:581-587
27. Morra di Cella S, Veglio F, Mulatero P, Christensen V, Aycock K, Zhu Z, Gomez-Sanchez EP, Gomez-Sanchez CE 2002 A time-re- solved fluoroimmunoassay for 18-oxocortisol and 18-hydroxycor- tisol. Development of a monoclonal antibody to 18-oxocortisol. J Steroid Biochem Mol Biol 82:83-88
28. Mikhaylova IV, Kuulasmaa T, Jääskeläinen J, Voutilainen R 2007 Tumor necrosis factor-« regulates steroidogenesis, apoptosis, and cell viability in the human adrenocortical cell line NCI-H295R. En- docrinology 148:386-392
29. Planas-Silva MD, Means AR 1992 Expression of a constitutive form of calcium/calmodulin dependent protein kinase II leads to arrest of the cell cycle in G2. EMBO J 11:507-517
30. Chanklan R, Aihara E, Koga S, Takahashi H, Mizunuma M, Mi- yakawa T 2008 Inhibition of Ca2+-signal-dependent growth regu- lation by radicicol in budding yeast. Biosci Biotechnol Biochem 72: 132-138
31. Tao X, Avalos JL, Chen J, Mackinnon R 2009 Crystal structure of the eukaryotic strong inward-rectifier K+ channel Kir2.2 at 3.1 A resolution. Science 326:1668-1674
32. Heitzmann D, Derand R, Jungbauer S, Bandulik S, Sterner C, Schweda F, El Wakil A, Lalli E, Guy N, Mengual R, Reichold M, Tegtmeier I, Bendahhou S, Gomez-Sanchez CE, Aller MI, Wisden W, Weber A, Lesage F, Warth R, Barhanin J 2008 Invalidation of TASK1 potassium channels disrupts adrenal gland zonation and mineralocorticoid homeostasis. EMBO J 27:179-187
33. Davies LA, Hu C, Guagliardo NA, Sen N, Chen X, Talley EM, Carey RM, Bayliss DA, Barrett PQ 2008 TASK channel deletion in mice causes primary hyperaldosteronism. Proc Natl Acad Sci USA 105: 2203-2208
34. Nelson MT, Cheng H, Rubart M, Santana LF, Bonev AD, Knot HJ, Lederer WJ 1995 Relaxation of arterial smooth muscle by calcium sparks. Science 270:633-637
35. Grimm PR, Irsik DL, Settles DC, Holtzclaw JD, Sansom SC 2009 Hypertension of Kcnmb1-/- is linked to deficient K secretion and aldosteronism. Proc Natl Acad Sci USA 106:11800-11805
36. Coyne MD, Cornelius P, Venditti N, Toscano DG, Gross MK, To- scano Jr WA 1985 Purification and properties of calmodulin from adrenal cortex. Arch Biochem Biophys 236:629-637
37. Antonini SR, Baldacchino V, Tremblay J, Hamet P, Lacroix A 2006 Expression of ACTH receptor pathway genes in glucose-dependent insulinotrophic peptide (GIP)-dependent Cushing’s syndrome. Clin Endocrinol (Oxf) 64:29-36
38. Wisgerhof M, Brown RD, Hogan MJ, Carpenter PC, Edis AJ 1981 The plasma aldosterone response to angiotensin II infusion in aldo- sterone-producing adenoma and idiopathic hyperaldosteronism. J Clin Endocrinol Metab 52:195-198
39. Kem DC, Weinberger MH, Higgins JR, Kramer NJ, Gomez-Sanchez C, Holland OB 1978 Plasma aldosterone response to ACTH in pri- mary aldosteronism and in patients with low renin hypertension. J Clin Endocrinol Metab 46:552-560
40. Seccia TM, Miotto D, De Toni R, Pitter G, Mantero F, Pessina AC, Rossi GP 2009 Adrenocorticotropic hormone stimulation during adrenal vein sampling for identifying surgically curable subtypes of primary aldosteronism: comparison of 3 different protocols. Hy- pertension 53:761-766
41. Sackmann S, Lichtenauer U, Shapiro I, Reincke M, Beuschlein F 2011 Aldosterone producing adrenal adenomas are characterized by activation of calcium/calmodulin-dependent protein kinase (CaMK) dependent pathways. Horm Metab Res 43:106-111
42. Lenzini L, Seccia TM, Aldighieri E, Belloni AS, Bernante P, Giuliani L, Nussdorfer GG, Pessina AC, Rossi GP 2007 Heterogeneity of aldosterone-producing adenomas revealed by a whole transcrip- tome analysis. Hypertension 50:1106-1113
43. Hamlet SM, Gordon RD, Gomez-Sanchez CE, Tunny TJ, Klemm SA 1988 Adrenal transitional zone steroids, 18-oxo and 18-hydroxy- cortisol, useful in the diagnosis of primary aldosteronism are ACTH- dependent. Clin Exp Pharmacol Physiol 15:317-322
44. Yamakita N, Mune T, Morita H, Yoshida H, Yasuda K, Miura K, Gomez-Sanchez CE 1994 Plasma 18-oxocortisol levels in the pa- tients with adrenocortical disorders. Clin Endocrinol (Oxf) 40:583- 587
45. Rey O, Young SH, Jacamo R, Moyer MP, Rozengurt E 2010 Ex- tracellular calcium sensing receptor stimulation in human colonic epithelial cells induces intracellular calcium oscillations and prolif- eration inhibition. J Cell Physiol 225:73-83
46. Baron JA, Beach M, Mandel JS, van Stolk RU, Haile RW, Sandler RS, Rothstein R, Summers RW, Snover DC, Beck GJ, Bond JH, Greenberg ER 1999 Calcium supplements for the prevention of colorectal adenomas. Calcium Polyp Prevention Study Group. N Engl J Med 340:101-107
47. Roderick HL, Cook SJ 2008 Ca2+ signalling checkpoints in cancer: remodelling Ca2+ for cancer cell proliferation and survival. Nat Rev Cancer 8:361-375