EHT
CrossMark + click for updates
Open Access
eISSN: 2233-6567
· Original Article
The effects of the standardized extracts of Ginkgo biloba on steroidogenesis pathways and aromatase activity in H295R human adrenocortical carcinoma cells
Mijie Kim1, Yong Joo Park2, Huiyeon Ahn3, Byeonghak Moon3, Kyu Hyuck Chung2, Seung Min Oh3
‘Oncology and Antimicrobial Products Division, National Institute of Food and Drug Safety Evaluation, Cheongju; 2School of Pharmacy, Sungkyunkwan University, Suwon; 3Department of Nanofusion Technology, Hoseo University, Asan, Korea
Objectives Aromatase inhibitors that block estrogen synthesis are a proven first-line hor- monal therapy for postmenopausal breast cancer. Although it is known that standard- ized extract of Ginkgo biloba (EGb761) induces anti-carcinogenic effects like the aroma- tase inhibitors, the effects of EGb761 on steroidogenesis have not been studied yet. Therefore, the effects of EGb761 on steroidogenesis and aromatase activity was studied using a H295R cell model, which was a good in vitro model to predict effects on human adrenal steroidogenesis.
Methods Cortisol, aldosterone, testosterone, and 17ß-estradiol were evaluated in the H295R cells by competitive enzyme-linked immunospecific assay after exposure to EGb761. Real-time polymerase chain reaction were performed to evaluate effects on critical genes in steroid hormone production, specifically cytochrome P450 (CYP11/ 17/19/21) and the hydroxysteroid dehydrogenases (3ß-HSD2 and 17ß-HSD1/4). Finally, aromatase activi- ties were measured with a tritiated water-release assay and by western blotting analysis. Results H295R cells exposed to EGb761 (10 and 100 µg/mL) showed a significant de- crease in 17ß-estradiol and testosterone, but no change in aldosterone or cortisol. Genes (CYP19 and 17ß-HSD1) related to the estrogen steroidogenesis were significantly de- creased by EGb761. EGb761 treatment of H295R cells resulted in a significant decrease of aromatase activity as measured by the direct and indirect assays. The coding se- quence/Exon PII of CYP19 gene transcript and protein level of CYP19 were significantly decreased by EGb761.
Conclusions These results suggest that EGb761 could regulate steroidogenesis-related genes such as CYP19 and 17ß-HSD1, and lead to a decrease in 17ß-estradiol and testos- terone. The present study provides good information on potential therapeutic effects of EGb761 on estrogen dependent breast cancer.
Keywords Ginkgo biloba extracts, Aromatase inhibitor, H295R cells, Steroidogenesis
Correspondence: Seung Min Oh 20 Hoseo-ro 79beon-gil, Baebang-eup, Asan 31499, Korea Tel: +82-41-540-9697 Fax: +82-41-540-9697 E-mail: ohsm0403@hoseo.edu
Received: March 17, 2016 Accepted: April 14, 2016 Published: May 9, 2016
This article is available from: http://e-eht.org/
EHT
Introduction
Breast cancer is the most common disease for women in Ko- rea [1]. Because estrogens are the main determinants in breast cancer, aromatase, the key enzyme of estrogen synthesis, has been considered one of the most important enzymes among the steroidogenesis enzymes [2,3]. Therefore, aromatase inhibitors (AIs) such as anastrozole, letrozole, and exemestane are used to treat breast cancer by depleting estrogen [3,4]. However, al- though AIs have been proven as a standard endocrine therapy medicines based on large clinical trials, they have limitations be- cause of their side effects, which include bone fracture, bone loss, and musculoskeletal events [5]. These limitations of syn- thetic medicines have spurred efforts to search for new com- pounds that could be effective at tolerable doses without ad- verse effects [6].
Ginkgo biloba is a tree that has been used in traditional Chinese medicine for about 5000 years and is now commercially culti- vated in France and the US [7]. Previous studies reported that Ginkgo biloba extract (EGb) has a biphasic effect on estrogen ac- tivity [8,9] and bone density through osteoblastic and anti-os- teoclastic effects [10]. EGb and its major constituents (querce- tin and kaempferol) were reported to regulate estrogen levels as aromatase inhibitors [11,12]. In addition, Park et al. [13] eluci- dated that standardized extract of Ginkgo biloba (EGb761) could induce anti-carcinogenic effects on breast cancer as the aromatase inhibitors. However, the effects of EGb761 on entire steroidogenesis pathways (aldosterone, cortisol, testosterone, and 17ß-estradiol synthesis) have not been studied yet. There- fore, in this study, the effects of EGb761 on steroidogenesis pathways and aromatase activities were evaluated.
In postmenopausal women, the steroidogenic enzymes are mainly expressed in the adrenal glands, which are the main source of estrogens. The human H295R adrenocortical carcino- ma cells have the physiologic features of zonally undifferentiated human fetal adrenal cells and express all the steroidogenic en- zymes essential for steroid hormone synthesis in the adult adre- nal cortex [14]. As such, the H295R cell line has been used broadly as an in vitro model to predict effects on human adrenal steroidogenesis [15,16]. In this study, the H295R cell model was used to evaluate effects of EGb761 on steroidogenesis path- ways. First, a cell viability test was carried out to find the appro- priate dose-range of EGb761 without cytotoxicity. Second, lev- els of four steroid hormones including cortisol, aldosterone, tes- tosterone, and 17ß-estradiol, were measured by competitive en- zyme-linked immunospecific assay (ELISA). Third, the genes required for steroid hormone production including steroido- genic acute regulatory protein (StAR), cytochrome P450
(CYP11, CYP17, CYP19, and CYP21), and the hydroxysteroid dehydrogenases (36-HSD2, 17ß-HSD1, and 17ß-HSD4) were quantified by real-time polymerase chain reaction (PCR). Final- ly, aromatase activity was measured with a tritiated water release assay and protein levels were measured by western blotting.
Materials and Methods
Cell Culture
H295R human adrenocarcinoma cells (CRL-2128) were pur- chased from the American Type Culture Collection (Fairfax, VA, USA) and cultured as a monolayer in H295R supplement- ed media, which is a 1:1 mixture of Dulbecco’s modified Eagle’s medium and Ham’s F-12 nutrient mixture (DMEM/F12) (Sig- ma-Aldrich, St. Louis, MO, USA) containing 1% ITS + Premix (BD Biosciences, San Diego, CA, USA), 2.5% Nu-Serum (BD Biosciences), 1.2 g/L Na2CO3 (Sigma-Aldrich), and 1% penicil- lin-streptomycin (GibcoBRL, Grand Island, NY, USA). Cells were cultured in a humidified environment at 37℃ containing 95% air/5% carbon dioxide. Medium was changed three times a week and cell subculture was performed every seven days.
Test Chemicals
The EGb761 were kindly provided and standardized by YuYu Pharma Inc. (Seoul, Korea). The EGb761 contained 24.7% fla- vones glycosides (including quercetin, kaempferol, and isorh- amnetin) and 6.1% terpene lactones (3.2% ginkgolides and 2.9% bilobalide), which represent the major active components of EGb761. The solution was prepared in 50% ethanol/water at 250 mg/mL. Dimethyl sulfoxide (DMSO) was purchased from Sigma-Aldrich. The radioactive solution, [16-3H] androst- 4-ene-3,17-dione, was purchased from PerkinElmer® (Waltham, MA, USA).
Cell Viability Test
To evaluate cell viability and to exclude cytotoxic concentra- tion ranges of EGb761, the cells were seeded onto 96-well plates at a density of 10000 cells/well with 200 uL of medium. After incubation with EGb761 (from one to 1000 µg/mL) for 24 hours, cell viability was measured by the WST-1 assay (Roche, Mannheim, Germany).
Hormone Measurement (Aldosterone, Cortisol, Testosterone, and 17ß-estradiol)
Cells were seeded into 24-well plates at a density of 30×104 cells/mL in 1 mL of medium per well. After 24 hours, the cells were exposed to EGb761 (10 and 100 µg/mL) for 24 hours. In instances where exposure resulted in cell viability of less than
85%, the cells were not used for the evaluation of hormone pro- duction [17]. Hormones were measured by competitive ELISA following the manufacturer’s recommendations (Cayman Chem- ical, Ann Arbor, MC, USA; aldosterone [Catalog no. 1004377], cortisol [Catalog no. 500360], testosterone [Catalog no. 582701], and 17ß -estradiol [Catalog no. 582251]). The detection limit of aldosterone, cortisol, testosterone, and 17ß-estradiol were 24.02, 14.97, 11.71, and 22.75 pg/mL, respectively.
Quantitative Real-time Polymerase Chain Reaction on Genes Related to Steroidogenesis in H295R Cells
To characterize the regulation of gene expression in cells, we performed real-time PCR using specific sense and anti-sense primers, in order to check the mRNA expression levels. Total RNA was purified from cells exposed to EGb761 (10 and 100 ug/mL) for 24 hours with Trizol® (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized from 2 µg of total RNA using AMV reverse-transcriptase (Promega, San Luis Obispo, CA, USA) in a 20 uL reaction. Quantitative real-time PCR reaction mixtures (15 uL) contained 1 µL (0.1 µM) of forward and re- verse primers, 3 uL of cDNA sample, and 7.5 uL of 2x SYBR Green™ PCR Master Mix. The following thermal cycle profile was used: denaturing at 94℃ for 10 minutes, followed by 40 cy- cles of denaturing for 15 seconds at 94℃, annealing with exten- sion at 60℃ to 64 ℃ (Table 1) for one minute, 72℃ for 30 sec- onds, respectively, and a final cycle of 94℃ for 15 seconds, 50℃ for one minute, and 94℃ for 15 seconds. The primer sequences were synthesized by Bioneer (Daejeon, Korea) and are shown in Table 1. Expression levels of mRNA were quantified by use of the threshold cycle (Ct) method. Ct values for each gene of in- terest were normalized to ß-actin.
‘In-cell’ Aromatase Activity Assay - Tritiated Water- Release Assay
Indirect and direct effects on aromatase activity were mea- sured using a tritiated water-release assay as described by Leph-
art and Simpson [18] with minor modifications. This assay was performed by measuring the amount of [3H]H2O released upon the conversion of [10-3H]androst-4-ene-3,17-dione to es- trone [18,19]. Cells were plated in 24-well plates with growth media and exposed to EGb761 (10 and 100 µg/mL) in the in- cubation media after cells were 80% confluent. The incubation media were prepared in 0.1% (v/v) ethanol in H295R supple- mented media for H295R cells. The experiments were conduct- ed in three different ways: (1) Indirect aromatase activity: cells plated in 24-well plates were exposed to EGb761 (10 and 100 ug/mL) for 24 hours and then the cells were incubated in 0.25 mL of supplemented medium containing 54 nM [1]-3H] an- drost-4-ene-3,17-dione (PerkinElmer®) for 2 hours; (2) Direct aromatase activity: untreated cells were exposed to EGb761 (10 and 100 µg/mL) while a 2 hours tritium-release assay was con- ducted to assess direct interaction with the enzyme. Aromatase enzyme activity was measured as described by Kim et al. [11].
Western Blot Analysis
Protein from the cells exposed to EGb761 (10 and 100 µg/ mL) was extracted with radioimmuno-precipitation assay (RIPA; Thermo Scientific, Rockford, IL, USA) buffer contain- ing 1% protease inhibitor cocktail solution (GenDEPOT, Hous- ton, TX, USA). Lysate proteins (50 µg) denatured with 2x sam- ple buffer (Bio-RAD, Hercules, CA, USA) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto nitrocellulose blotting membranes. Immu- nodetection was performed using anti-aromatase (1:1000, ab- cam35604, Abcam Plc, Cambridge, UK) and anti-actin anti- bodies (1:4000, 13E5, Cell Signaling Technology, Danvers, MA, USA), respectively. The corresponding anti-rabbit horse- radish peroxidase (HRP) conjugated secondary antibody (Ab- cam Plc) was used. An ECLplus detection kit (Thermo Fisher Scientific Inc., Rockford, IL, USA) provided the chemilumines- cence substrate for HRP, and the targeted protein was visualized by autoradiography.
| Gene | Amplicon size (bp) | Annealing temperature (°℃) | Forward primer (5'->3') | Reverse primer (5'->3') |
|---|---|---|---|---|
| B-actin | 100 | 64 | CACTCTTCCAGCCTTCCTTCC | AGGTCTTTGCGGATGTCCAC |
| CYP11A | 137 | 62 | GAGATGGCACGCAACCTGAAG | CTTAGTGTCTCCTTGATGCTGGC |
| CYP11B1 | 541 | 62 | GGCAGAGGCAGAGATGCTG | TCTTGGGTTAGTGTCTCCACCTG |
| CYP11B2 | 146 | 62 | TCCAGGTGTGTTCAGTAGTTCC | GAAGCCATCTCTGAGGTCTGTG |
| CYP17A1 | 134 | 64 | AGCCGCACACCAACTATCAG | TCACCGATGCTGGAGTCAAC |
| CYP19 | 128 | 64 | AGGTGCTATTGGTCATCTGCTC | TGGTGGAATCGGGTCTTTATGG |
| CYP21A2 | 108 | 64 | CGTGGTGCTGACCCGACTG | GGCTGCATCTTGAGGATGACAC |
| 3ß-HSD2 | 95 | 60 | TGCCAGTCTTCATCTACACCAG | TTCCAGAGGCTCTTCTTCGTG |
| 17ß-HSD1 | 136 | 64 | CTCCCTCTGACCAGCAACC | TGTGTCTCCCACGCAATCTC |
| 17ß-HSD4 | 121 | 62 | TGCGGGATCACGGATGACTC | GCCACCATTCTCCTCACAACTC |
Statistical Methods
SigmaPlot version 12.0 (Jandel Scientific, San Rafael, CA, USA) and Excel 2013 (Microsoft Co., Redmond, WA, USA) were used to analyze the data. The data from each assay were expressed as mean ± standard deviation. Statistical analysis was performed using the SPSS version 18.0 (SPSS Inc., Chicago, IL, USA) program. Differences between groups were tested by Duncan’s post-hoc test following a one-way analysis of variance (ANOVA). Statistical significance was accepted at p < 0.05.
120
100
*
Cell viability (%)
80
**
60
40
20
0
0
10
100
250
500
750
1000
EGb761 (µg/mL)
Results
Cell Viability Effects of Standardized Extract of Ginkgo biloba
Since cytotoxic concentrations should be excluded from the experiments, we first evaluated cell viability following exposure to various concentrations of EGb761 with the WST-1 assay. Cell viability was significantly inhibited at 750 and 1000 µg/mL EGb761. The observed viability was greater than 85% in the EGb761 concentration range of 10 to 100 µg/mL (Figure 1), which then was chosen as the concentration range to be used in
125
Hormone concentration (% of control)
100
75
**
50
**
Aldosterone
**
25
Cortisol
**
Testosterone
17ß-estradiol
0
0
10
100
EGb761 (µg/mL)
1.2
CYP11A
CYP17A1
3ß-HSD2
1.2
CYP21A2
CYP11B1
CYP11B2
1.2
CYP19
17ß-HSD1
17ß-HSD4
Relative gene expression
1.0
T
1.0
1.0
T
T
Relative gene expression
T
Relative gene expression
*
**
0.8
0 .8
0.8
**
0.6
0.
6
0.6
0.4
0.4
0.4
0.2
0.2
0.2
0
0
0
0 10 100
0 10 100
0 10 100
0 10 100
0 10 100
0 10 100
0 10 100
0 10 100
0 10 100
EGb761 (µg/mL)
A
EGb761 (ug/mL)
B
EGb761 (ug/mL)
C
the experiments.
The Effects of Standardized Extract of Ginkgo biloba on Hormone Concentrations in H295R Cells
As shown in Figure 2, exposure to EGb761 (10 and 100 µg/ mL) resulted in a significant decrease in 17ß-estradiol (diamond symbol) and testosterone production (square symbol). Howev- er, cortisol (triangle symbol) and aldosterone (circle symbol) levels were not significantly changed in H295R cells exposed to 10 and 100 µg/mL of EGb761.
The Effects of Standardized Extract of Ginkgo biloba on Expression of Enzymes Related to Steroidogenesis Pathways
As shown in Figure 3, the mRNA expression of nine genes, in- cluding CYP11A, CYP17A1, 3ß-SD2, CYP21A2, CYP11B1, CYP11B2, CYP19, 17ß-HSD1, and 17ß-HSD4 were evaluated in H295R cells exposed to EGb761. The mRNA expression of aldosterone/cortisol-related genes such as CYP11A, CYP17A1, 3-HSD2, CYP21A2, CYP11B1, CYP11B2, and 17ß-HSD4 showed no significant changes in response to EGb761 exposure. However, the mRNA expression of CYP19 and 170-HSD1, which are related to 17ß-estradiol and testosterone synthesis, were significantly decreased by EGb761.
Effects of Standardized Extract of Ginkgo biloba on Aromatase Activity
As shown in Figure 4A, the expression level of the aromatase coding region sequences (CDS) as well as promoter region se- quences (Exon PII) were decreased by EGb761. Western blot- ting confirmed that CYP19 protein synthesis was reduced by
EGb761 exposure (Figure 4B). In addition, aromatase activity measured by both direct and indirect methods was significantly inhibited by exposure to EGb761 (10 and 100 µg/mL) when compared with control (Figure 4℃).
Discussion
The effects of EGb761 on the synthesis of the four steroid hor- mones (aldosterone, cortisol, testosterone, and 17ß-estradiol) were evaluated using the human H295R adrenocortical cell line as an in vitro model. In the H295R cells exposed to EGb761 at non-cytotoxic concentrations (10 and 100 µg/mL, Figure 1), testosterone and 17-estradiol were significantly decreased, whereas aldosterone and cortisol were not (Figure 2).
These steroid hormones are synthesized from cholesterol by a series of steroidogenesis pathways, which are dependent on cy- tochrome P450 enzymes and HSDs [20]. As the first step in the steroidogenesis pathway, cholesterol transported into the inner mitochondrial membrane by StAR [21] is converted into preg- nenolone by the cholesterol side-chain cleavage enzyme (CYP- 450scc), which is known as CYP11A1 [16]. In addition, aldo- sterone and cortisol are synthesized by regulation of the CY- P17A1, 36-HSD2, CYP21A2, and CYP11B1/2 enzymes. In re- al-time PCR analysis, EGb761 exposure did not affect the ex- pression of these genes (Figure 3), which was consistent with the results showing no change in aldosterone and cortisol levels in H295R cells exposed to EGb761. Although the cortisol level was not significantly changed by EGb761 exposure in this in vi- tro model system (H295R cell line), several researchers have re- ported regulation of the cortisol level by EGb761 exposure. Ku- dolo [22] reported that ingestion of EGb has an effect on the
120
Direct
CDS
100
I
Indirect
Exon I.1
Aromatase activity (%)
I
80
**
Aromatase
**
Exon I.3
7
60
Exon PII
ß-actin
**
**
Control
10
100
40
B-actin
EGb761 (ug/mL)
20
Control
10
100
EGb761 (ug/mL)
0
0
10
100
A
B
EGb761 (µg/mL)
C
EGb761
Cholesterol
H295R cell
CYP11A1
Pregnenolone
CYP17A1
17a-OH-
CYP17A1
pregnenolone
Dihydroepiandrosterone
3B-HSD2
3ß-HSD2
3B-HSD2
Progesterone
CYP17A1
17a-OH-
CYP17A1
progesterone
Androstenedione
CYP21A2
CYP21A2
CYP19
17- HSD1
11-Deoxy- corticosterone
11-Deoxycortisol
Estrone
:17B-
Testosterone
CYP11B1
CYP11B1
CYP11B2
17₿- HSD1
HSD4
CYP19
Corticosterone
Cortisol
17B-Estradiol Į
CYP11B2
Aldosterone
hypothalamic-pituitary-adrenal (HPA) axis leading to reduced basal cortisol levels and reduced cortisol production in response to an acute hyperglycemic challenge. In addition, EGb761 may inhibit cortisol release in response to some stress stimuli [23]. The H295R assay used in this study is not intended to identify substances that affect steroidogenesis due to effects on the hy- pothalamic-pituitary-gonadal and HPA axes [19], which may produce different outcomes between in vitro and in vivo cortisol levels.
In regard to the steroidogenesis pathway (Figure 5), testoster- one and 17ß-estradiol levels can be regulated by 17ß-HSD1 and CYP19. CYP19, which is related to aromatase activity, is the key enzyme responsible for the final rate-limiting reaction in 17ß-estradiol production [24]. 170-HSD1 is the most well characterized of the 17ß-HSDs catalyzing the reaction from es- trone to estradiol [25], whereas 17ß-HSD4, as an oxidative en- zyme, catalyzes the conversion of estradiol to estrone [26]. In this study, EGb761 treatment of H295R cells resulted in a sig- nificant reduction of testosterone and 17ß-estradiol levels (Fig- ure 2), which was consistent with the results showing a signifi- cant decrease in 170-HSD1 and CYP19 at the concentrations tested (Figure 3). Generally, an increased level of 17ß-estradiol could stimulate the proliferation of the tumor tissue via the es- trogen receptor, leading to estrogen-dependent breast cancer. In breast cancer patients that have high 17ß-HSD1 and CYP19 ex- pression, inhibition of these enzymes may provide therapeutic benefit by depriving the tumor of 170-estradiol [27,28]. There-
fore, we suggest that EGb761 should be evaluated as a therapeu- tic agent against estrogen-dependent breast cancer, as an inhibi- tor of 17ß-HSD1 and CYP19.
EGb761 showed stronger inhibition of CYP19 gene expres- sion than of 17ß-HSD1 (Figure 3). The regulation of the CYP19 gene is controlled by several distinct tissue-specific pro- moters, which are associated with the placenta (I.1 and 1.2a), skin/normal breast adipose tissue (I.4), endothelial cells (I.7), brain (I.f), bone (I.6), fetal tissues (I.5), adipose tissue (I.4), en- dometriosis/ovary (II), and breast tumors (I.7 and I.3/II) [29,30]. These promoters regulate the transcription of the aro- matase gene in human tissues [31]. H295R cells showed aroma- tase activation by promoter 1.3/II-specific aromatase tran- scripts, but did not detect aromatase activity by promoter 1.4 [32]. In this study, H295R cells contained Exon I.1, I.3 and PII, and EGb761 showed a significant decrease of only PII transcript (Figure 4A), which is the most active promoter of aromatase gene expression in H295R cells [32,33]. In previous studies, EGb761 inhibited expression of Exon 1.3/PII in MCF-7 AROM cells [13] and Exon 1.1 in human placenta JEG-3 cells [11,12]. These results indicated that EGb761 could regulate tis- sue-specific transcription of the aromatase gene.
The aromatase activities in H295R cells exposed to EGb761 were significantly inhibited by both the direct and indirect path- ways (Figure 4C). Direct interactions with the aromatase en- zyme, which had the typical inhibitory action, can include com- petition of the substance with the ligand, or interference with
the conversion process of testosterone to 170-estradiol. On the other hand, indirect inhibition is associated with gene expres- sion or feedback mechanisms [19]. Direct inhibition of aroma- tase activity by EGb761 was consistent with the results in MCF- 7 AROM cells exposed to EGb761 [13]. In addition, the signifi- cant inhibition of CYP19 mRNA and protein levels could sup- port indirect inhibition of aromatase activity by EGb761 expo- sure. Therefore, we suggest that a significant decrease of 17ß-estradiol by EGb761 could be induced by the inhibition of aromatase activity by both the indirect and direct pathways.
Among the chemicals displaying a strong inhibitory effect on hormone secretion, a few have been used clinically in the treat- ment of adrenal disorders and as steroidogenic inhibitors [34]. Aminoglutethimide, a “generation I” aromatase inhibitor, has been reported to act as a potent inhibitor of CYP450scc. Due to its direct inhibition of CYP450scc and the aromatase enzyme, it was used to treat Cushing’s syndrome (a disease that causes an increase in cortisol) and breast cancer, respectively [35,36]. Ex- posure to aminoglutethimide resulted in a decrease of testoster- one and 170-estradiol [15]. This mechanism is consistent with the results showing decreased testosterone and 17ß-estradiol production by EGb761, which was expected due to the inhibi- tion of 170-HSD1 and CYP19, respectively. Therefore, these aminoglutethimide results support the assertion that EGb761 also could be an effective natural inhibitor of aromatase as well as steroidogenic enzymes and hormones.
In conclusion, regarding steroidogenesis in H295R cells, EGb761 significantly decreased CYP19 and 17ß-HSD1 gene expression, which are related to sex steroid hormones. Specifi- cally, inhibition of the aromatase enzyme via direct and indirect pathways in H295R cells exposed to EGb761 could induce a significant decrease of 17ß-estradiol secretion. In addition, EGb761 showed no change on the secretion of other steroid hormones such as aldosterone and cortisol. Down-regulation of CYP19/17ß-HSD1 and depletion of 17ß-estradiol and testos- terone have been known to play an important role in hormone dependent breast cancer. Therefore, we suggest that EGb761 should be evaluated as a therapeutic agent in hormone depen- dent breast cancer because of its specific sex steroid hormone down-regulation.
Acknowledgements
This study was supported by a grant from the National Re- search Foundation of Korea funded by the Korea Government (NRF-2013R1A1A2A10060109).
Conflict of Interest
The authors have no conflicts of interest associated with mate- rial presented in this paper.
ORCID
Mijie Kim https://orcid.org/0000-0002-4715-7641
Yong Joo Park https://orcid.org/0000-0002-0528-6197
Huiyeon Ahn https://orcid.org/0000-0001-5030-1600 Byeonghak Moon ttps://orcid.org/0000-0002-2018-6418 Kyu Hyuck Chung https://orcid.org/0000-0003-4283-0742 Seung Min Oh https://orcid.org/0000-0002-5701-8960
References
1. Jung KW, Won YJ, Kong HJ, Oh CM, Cho H, Lee DH, et al. Can- cer statistics in Korea: incidence, mortality, survival, and prevalence in 2012. Cancer Res Treat 2015;47(2):127-141.
2. Almstrup K, Fernández MF, Petersen JH, Olea N, Skakkebaek NE, Leffers H. Dual effects of phytoestrogens result in u-shaped dose- response curves. Environ Health Perspect 2002;110(8):743-748.
3. Macedo LF, Sabnis G, Brodie A. Aromatase inhibitors and breast cancer. Ann N Y Acad Sci 2009;1155:162-173.
4. Mokbel R, Karat I, Mokbel K. Adjuvant endocrine therapy for postmenopausal breast cancer in the era of aromatase inhibitors: an update. Int Semin Surg Oncol 2006;3:31.
5. Janni W, Hepp P. Adjuvant aromatase inhibitor therapy: outcomes and safety. Cancer Treat Rev 2010;36(3):249-261.
6. Ullah MF. Cancer multidrug resistance (MDR): a major impedi- ment to effective chemotherapy. Asian Pac J Cancer Prev 2008; 9(1):1-6.
7. Dubey AK, Shankar PR, Upadhyaya D, Deshpande VY. Ginkgo bi- loba — an appraisal. Kathmandu Univ Med J (KUMJ) 2004;2(3): 225-229.
8. Oh SM, Chung KH. Estrogenic activities of Ginkgo biloba extracts. Life Sci 2004;74(11):1325-1335.
9. Oh SM, Chung KH. Antiestrogenic activities of Ginkgo biloba ex- tracts. J Steroid Biochem Mol Biol 2006;100(4-5):167-176.
10. Oh SM, Kim HR, Chung KH. Effects of Ginkgo biloba on in vitro osteoblast cells and ovariectomized rat osteoclast cells. Arch Pharm Res 2008;31(2):216-224.
11. Kim MJ, Park YJ, Chung KH, Oh SM. The inhibitory effects of the standardized extracts of Ginkgo biloba on aromatase activity in JEG-3 human choriocarcinoma cells. Phytother Res 2013;27(12): 1756-1762.
12. Park YJ, Choo WH, Kim HR, Chung KH, Oh SM. Inhibitory aro- matase effects of flavonoids from Ginkgo biloba extracts on estrogen biosynthesis. Asian Pac J Cancer Prev 2015;16(15):6317-6325.
13. Park YJ, Ahn HY, Kim HR, Chung KH, Oh SM. Ginkgo biloba ex- tract EGb 761-mediated inhibition of aromatase for the treatment of hormone-dependent breast cancer. Food Chem Toxicol 2016; 87:157-165.
Environmental Health and Toxicology 2016;31:e2016010
14. Gazdar AF, Oie HK, Shackleton CH, Chen TR, Triche TJ, Myers CE, et al. Establishment and characterization of a human adreno- cortical carcinoma cell line that expresses multiple pathways of ste- roid biosynthesis. Cancer Res 1990;50(17):5488-5496.
15. Hecker M, Newsted JL, Murphy MB, Higley EB, Jones PD, Wu R, et al. Isolation and identification of 3-trifluoromethyl-4-nitrophe- nyl glucuronide from bile of rainbow trout exposed to 3-trifluoro- methyl-4-nitrophenol. Toxicol Appl Pharmacol 1973;24(1):114- 124.
16. Hilscherova K, Jones PD, Gracia T, Newsted JL, Zhang X, Sander- son JT, et al. Assessment of the effects of chemicals on the expres- sion of ten steroidogenic genes in the H295R cell line using real-time PCR. Toxicol Sci 2004;81(1):78-89.
17. Gracia T, Hilscherova K, Jones PD, Newsted JL, Higley EB, Zhang X, et al. Modulation of steroidogenic gene expression and hormone production of H295R cells by pharmaceuticals and other environ- mentally active compounds. Toxicol Appl Pharmacol 2007; 225(2):142-153.
18. Lephart ED, Simpson ER. Assay of aromatase activity. Methods Enzymol 1991;206:477-483.
19. Higley EB, Newsted JL, Zhang X, Giesy JP, Hecker M. Assessment of chemical effects on aromatase activity using the H295R cell line. Environ Sci Pollut Res Int 2010;17(5):1137-1148.
20. Hanukoglu I. Steroidogenic enzymes: structure, function, and role in regulation of steroid hormone biosynthesis. J Steroid Biochem Mol Biol 1992;43(8):779-804.
21. Ohlsson A, Ullerås E, Cedergreen N, Oskarsson A. Mixture effects of dietary flavonoids on steroid hormone synthesis in the human adrenocortical H295R cell line. Food Chem Toxicol 2010;48(11): 3194-3200.
22. Kudolo GB. Effect of Ginkgo biloba extract ingestion on plasma to- tal cortisol levels during an oral glucose tolerance test in normal glucose tolerant individuals. Food Nutr Sci 2014;5:1561-1567.
23. Jezova D, Duncko R, Lassanova M, Kriska M, Moncek F. Reduc- tion of rise in blood pressure and cortisol release during stress by Ginkgo biloba extract (EGb 761) in healthy volunteers. J Physiol Pharmacol 2002;53(3):337-348.
24. Wang Y, Ye L, Leung LK. A positive feedback pathway of estrogen biosynthesis in breast cancer cells is contained by resveratrol. Toxi- cology 2008;248(2-3):130-135.
25. Peltoketo H, Isomaa V, Poutanen M, Vihko R. Expression and reg- ulation of 17ß-hydroxysteroid dehydrogenase type 1. J Endocrinol 1996;150:S21-S30.
26. Luu-The V. Analysis and characteristics of multiple types of human 17beta-hydroxysteroid dehydrogenase. J Steroid Biochem Mol Biol 2001;76(1-5):143-151.
27. Day JM, Tutill HJ, Purohit A, Reed MJ. Design and validation of specific inhibitors of 17beta-hydroxysteroid dehydrogenases for therapeutic application in breast and prostate cancer, and in endo- metriosis. Endocr Relat Cancer 2008;15(3):665-692.
28. Cazzaniga M, Bonanni B. Breast cancer chemoprevention: old and new approaches. J Biomed Biotechnol 2012;2012:985620.
29. Mahendroo MS, Mendelson CR, Simpson ER. Tissue-specific and hormonally controlled alternative promoters regulate aromatase cytochrome P450 gene expression in human adipose tissue. J Biol Chem 1993;268(26):19463-19470.
30. Sebastian S, Bulun SE. A highly complex organization of the regula- tory region of the human CYP19 (aromatase) gene revealed by the Human Genome Project. J Clin Endocrinol Metab 2001;86(10): 4600-4602.
31. Bulun SE, Lin Z, Imir G, Amin S, Demura M, Yilmaz B, et al. Regu- lation of aromatase expression in estrogen-responsive breast and uterine disease: from bench to treatment. Pharmacol Rev 2005; 57(3):359-383.
32. Watanabe M, Nakajin S. Forskolin up-regulates aromatase (CYP19) activity and gene transcripts in the human adrenocortical carcino- ma cell line H295R. J Endocrinol 2004;180(1):125-133.
33. Sanderson JT, Hordijk J, Denison MS, Springsteel MF, Nantz MH, van den Berg M. Induction and inhibition of aromatase (CYP19) activity by natural and synthetic flavonoid compounds in H295R human adrenocortical carcinoma cells. Toxicol Sci 2004;82(1):70- 79.
34. Gross BA, Mindea SA, Pick AJ, Chandler JP, Batjer HH. Medical management of Cushing disease. Neurosurg Focus 2007;23(3): E10.
35. Foster AB, Jarman M, Leung CS, Rowlands MG, Taylor GN. Ana- logues of aminoglutethimide: selective inhibition of cholesterol side-chain cleavage. J Med Chem 1983;26(1):50-54.
36. Johansson K, Ohlsson K, Ingvar C, Albertsson M, Ekdahl C. Fac- tors associated with the development of arm lymphedema follow- ing breast cancer treatment: a match pair case-control study. Lym- phology 2002;35(2):59-71.
37. Furuta C, Noda S, Li C, Suzuki AK, Taneda S, Watanabe G, et al. Nitrophenols isolated from diesel exhaust particles regulate ste- roidogenic gene expression and steroid synthesis in the human H295R adrenocortical cell line. Toxicol Appl Pharmacol 2008; 229(1):109-120.
38. von Krogh K, Harjen H, Almås C, Zimmer KE, Dahl E, Olsaker I, et al. The effect of valproate and levetiracetam on steroidogenesis in forskolin-stimulated H295R cells. Epilepsia 2010;51(11):2280- 2288.