CTNNB1 Knockdown Inhibits Cell Proliferation and Aldosterone Secretion Through Inhibiting Wnt/B-Catenin Signaling in H295R Cells
Article reuse guidelines: sagepub.com/journals-permissions DOI: 10.1177/1533033820979685
journals.sagepub.com/home/tct SAGE
Tingting Zhou, MM’ , Pengwei Luo, MM1,2, Liang Wang, MD’, Shiwei Yang, MM’, Shiyuan Qin, MM’, Zhitao Wei, MD2, and Jiwen Liu, BM’
Abstract
Aldosterone-producing adenomas (APA) is one of the causative factors of primary aldosteronism. Previous studies have sug- gested that there are somatic CTNNBI mutations in APA, but the specific mechanism of CTNNB/ mutation in APA tumorigenesis and aldosterone secretion remains unclear. In the present study, human adrenocortical carcinoma cell line H295 R was used to establish stable CTNNB/ knockdown cell lines. Cell proliferation and aldosterone secretion of H295 R cells in response to angiotensin II (Agn II) were analyzed. We found that CTNNB/ knockdown reduced ß-catenin expression and inhibited pro- liferation of H295 R cells. CTNNBI knockdown inhibited Wnt/B-catenin signaling pathway and downregulated expression of downstream genes including axin 2, lymphoid enhancer binding factor 1 (LEF1), and cyclin D1. In addition, CTNNB1 knockdown decreased responses of H295 R cells to Agn II and decreased aldosterone secretion. Our findings suggest that CTNNB1 knockdown can inhibit H295 R cell proliferation and decrease aldosterone secretion in the responses of H295 R cells to Ang II through inhibiting Wnt/B-catenin signaling pathway, indicating that targeting Wnt/B-catenin signaling pathway may be an important approach to decrease aldosterone secretion in the treatment of aldoster-producing adenomas.
Keywords
aldosterone-producing adenomas, CTNNB, Wnt/B-catenin signaling pathway, aldosterone secretion, H295 R cell
Received: May 08, 2020; Revised: October 09, 2020; Accepted: November 02, 2020.
Introduction
Primary aldosteronism (PA), which is characterized by hyper- aldosteronism, affects 20% of patients with refractory hyper- tension.1 The excessive production of aldosterone leads to hypertension, low plasma renin activity, varying degrees of hypokalemia, and metabolic alkalosis.2 Now, PA is being recognized as the most common cause of secondary hyperten- sion with a prevalence of 5-10% in hypertensive individuals and up to 20% in therapy-resistant hypertension.3,4 The patho- genesis of PA is caused by adrenal aldosterone-producing ade- nomas (APA) or bilateral hyperplasia in 95% of patients.5 Clinical therapy of PA relies on surgical resection and/or treat- ment with mineralocorticoids antagonists to minimize hyper- tension.6,7 However, the medication time is still inconclusive and serious side effects are still not resolved. Therefore, exist- ing treatment strategies are limited, which warrants exploring
the molecular mechanisms of PA to improve therapeutic outcomes.
Wnt/B-catenin signaling pathway has extensive biological effects and is relatively conservative in evolution, which has important effects on ontogeny, cell differentiation, apoptosis and necrosis.8 Previous studies indicate that the abnormal activated
Department of Urology, The General Hospital of Western Theater Command PLA, Chengdu, China
2 Department of Urology, The First Affiliated Hospital of Chengdu Medical College
Corresponding Author:
Tingting Zhou, Department of Urology, The General Hospital of Western Theater Command PLA, No. 270, Rongdu Road, Chengdu, Sichuan 610081 China.
Email: 10391904@qq.com
CC
S
BY
NC
| Target gene | Forward primer sequence (5'-3') | Reverse primer sequence (5'-3') |
|---|---|---|
| CTNNB1 | CCCAGAATGCAGTTCGCCTT | TAGTCGTGGAATGGCACCCT |
| AXIN2 | CACCACCACCACCACCATTCG | ACATGCTTCGTCGTCTGCTTGG |
| LEF1 | AGATTCTTGGCAGAAGGTGGCATG | GGACCTGTACCTGATGCAGATTCC |
| CYP11B1 | GAACTGTCGCCAGATGCCAT | CGCTCCAGAATCAGACCCAC |
| CYP11B2 | GTGACCGCAGGTTGCTTTCC | AGCCATCTCTGAGGTCTGTGC |
| Cyclin D1 | GCTGCGAAGTGGAAACCATC | CCTCCTTCTGCACACATTTGAA |
| B-actin | CCTGGCACCCAGCACAAT | GGGCCGGACTCGTCATAC |
Wnt/ß-catenin pathway has been involved in tumor progression, such as breast cancer, colorectal cancer, and ovarian cancer.9-
9-11 B-catenin is the core molecule of Wnt/B-catenin signaling path- way, which has transcriptional regulatory activity and is encoded by CTNNB1 gene, which located on human chromosome 3p21~22, with a total length of 23.2 kb and 16 exons.11,12 Abnormal Wnt/B-catenin activation caused by somatic CTNNB1 mutations has been found in APA,13 and silencing CTNNB1 has been shown to inhibit cell proliferation and stimulates apoptosis in APA cell line H295 R through decreasing Wnt/B-catenin- LEF/TCF dependent transcription.14 Transgenic mice with spe- cific constitutive activation of ß-catenin in the adrenal cortex present with increased aldosterone production and even a risk of adrenocortical tumors.15,16 These researches suggest that Wnt/B- catenin signaling pathway triggers off APA tumorigenesis and may be involved in aldosterone secretion.
APA patients with CTNNB1 mutation are older and have more obvious hypertension symptoms. After adrenalectomy, CTNNB1 mutation carriers have a higher likelihood of residual hypertension than other APA patients.17 Akerstrom et al reported that APA tissue containing the CTNNB1 mutant gene has a high expression of CYP11B2.13 As the last rate-limiting enzyme for aldosterone synthesis, CYP11B2 expression is up- regulated by angiotonin II (Ang II) through activating calcium signaling to induce aldosterone secretion.18 The specific mechanism of CTNNB1 mutation in APA-induced hyperaldos- teronism remains unclear.
In order to explore the effect of Wnt/B-catenin signaling path- way on the development of APA and to better understand the role of CTNNB 1 gene in APA cell proliferation and aldosterone secre- tion, we knocked down CTNNB1 gene expression in vitro and investigated the effect of Wnt/B-catenin signaling pathway on cell proliferation and aldosterone secretion of human adrenocortical carcinoma cell line H295 R. Our study suggests that Wnt/B-cate- nin signaling pathway is a vital role in mediating the secretion of aldosterone in the responses of H295 R cells to Ang II.
Materials and Methods
Cell Culture
Human adrenocortical carcinoma H295 R cell line was culti- vated in Dulbecco’s Modified Eagle Medium (DMEM)/Ham’s F12 medium complemented with 2 mM L-glutamine, 10% fetal bovine serum (FBS), 50 U/mL penicillin and 100 mg/mL
streptomycin, at 37℃ with 5% CO2. All media and supple- ments in this study were purchased from Invitrogen (Carlsbad, CA, USA).
CTNNB1 Knockdown
CTNNB1 was knocked down in H295 R cells with siRNA (RiboBio Co., Ltd., Guangzhou, China) in accordance with the manufacturer’s instructions. There were 3 target sequences: si-CTNNB1_001, 5’-TGGTTGCCTTGCTCAACAA-3’; si- CTNNB1_002, 5’-GCTTGGAATGAGACTGCTG-3’; si- CTNNB1_003, 5’-AGCTGATATTGATGGACAG-3’. The corresponding negative control sequence for the target gene was purchased from RiboBio Co., Ltd. To stably and efficiently knockdown CTNNB1 in H295 R cells, siRNA targeting the si-CTNNB1_003 coding sequence 5’-AGCTGATATTGATG- GACAG-3’ was designed and inserted into a pGMLV- SC5RNAi lentiviral vector (Genomeditech Co., Ltd, Shanghai, China), and an interference-free siRNA was used as a negative control. Quantitative reverse transcription PCR (qRT-PCR) and Western blot analysis were used to determine the knock- down efficiencies.
Total RNA Extraction and qRT-PCR
Total RNA extraction kit (Solarbio, Beijing, China) was used to extract total RNA from H295 R cells, and was in accordance with the manufacturer’s instructions. were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wal- tham, MA, USA) was used to determine the RNA concentra- tions. The iScript cDNA synthesis Kit (Bio-Rad, Hercules, CA, USA) was used to reverse-transcribe 1 microgram of total RNA to synthesize cDNA. CFX96 real-time system (Bio-Rad) and SYBR Green Supermix (Bio-Rad) were used to perform PCR and the procedures were performed according to the manufac- turer’s instructions. The sequences of the primers used in this study are listed in Table 1.
Western Blot Analysis
The prepared protein samples were resolved by sodium dode- cyl sulfate polyacrylamide gel electrophoresis on a 12% gel. Subsequently, in Tris buffered saline containing 5% skim milk and 0.1% Tween-20, the separated protein samples were trans- ferred to the nitrocellulose membranes after blocking at room
temperature for 1 h. The nitrocellulose membranes were placed in a suitable concentration of primary antibody and incubated for 18 h at 4 ℃. Then, membranes were placed in an incubator and stained with horseradish peroxidase-conjugated secondary antibodies for 1 hat room temperature. Finally, membranes were visualized with enhanced chemiluminescence (Super- Signal, Pierce, Rockford, IL) or ECL Plus (Amersham Phar- macia Biotech, Buckinghamshire, UK) substrates in accordance with the manufacturers’ instructions.
Cell Viability Assays
Cell viability was assessed by cell counting kit-8 (CCK-8) and colony formation assays. Briefly, cells were inoculated in a 6- well plate (Corning, Corning, NY, USA) at 500 cells per well after being treated with or without CTNNB1 knockdown. The cells were cultured for 10 days, and the medium was changed at least every 3 days depending on the growth of the cells. The colonies were washed with phosphate-buffered saline (PBS), fixed in methanol, and stained with crystal violet. The number of colonies was counted under a microscope. CCK-8 assays were performed in accordance with the manufacturer’s instructions.
Quantification of Aldosterone Using ELISA Kit
After incubation of H295 R cells with the respective control medium, aldosterone in the supernatant of the cells was mea- sured using a commercial human aldosterone ELISA Kit (ALD ELISA kit) in accordance with the manufacturer’s protocol (AmyJet Scientific, Wuhan, China).
Statistical Analysis
Each experiment was performed at least 3 times independently. The GraphPad Prism 7.0 statistical program (GraphPad, San Diego, CA, USA) was used for data analysis. The results were presented as the mean ± standard deviation (SD) unless oth- erwise indicated. The significance of the difference between the 2 groups was analyzed by 2-tailed Student’s t-tests. The differences between the 2 groups of count data were analyzed by chi-square test. P < 0.05 was considered statistically significant.
Results
CTNNBI Knockdown Reduced ß-Catenin Expression and Inhibited Proliferation of H295 R Cells
Stable CTNNB1 knockdown in H295 R cell lines were estab- lished to actively explore the function of endogenous CTNNB1. Based on qRT-PCR and western blot assays, si-h- CTNNB1_003 significantly downregulated the mRNA level and protein expression level of ß-catenin (Figure 1A). We utilized this lentivirus-mediated siRNA to induce CTNNB1 knockdown in H295 R cells (Figure 1B). CCK-8 assays showed that CTNNB1 knockdown markedly reduced cell viability,
compared with the control group (Figure 1C). Similarly, colony formation assays showed that cell proliferation was signifi- cantly decreased with CTNNB1 knockdown in H295 R cells (Figure 1D).
Wnt/B-Catenin Signaling Pathway Was Inhibited by CTNNB1 Knockdown
To explore the effects of CTNNB1 knockdown on Wnt/B-cate- nin signaling pathway in H295 R cells, we detected the down- stream target genes of Wnt/B-catenin signaling pathway including AXIN2 and lymphoid enhancer binding factor 1 (LEF1). Compared with the control group, the mRNA expres- sion levels of AXIN2 (Figure 2A) and LEF1 (Figure 2B) in CTNNB1 knockdown group were significantly decreased. Western blot analysis revealed that the protein expression lev- els of AXIN2 and LEF1 were downregulated in CTNNB1 knockdown group (Figure 2C). After adding angiotensin II (Ang II) to the cells for 6 hours, the results were not affected (Figure 1B and Figure 2A-C). These results suggest that CTNNB1 knockdown inhibited Wnt/ß-catenin signaling pathway.
CTNNB1 Knockdown Reduced Expression of Cycling D1
Since cycling D1 is known to play an important role in cell proliferation, qRT-PCR and Western blot analysis were used to detect expression of cycling D1 in H295 R cells. In CTNNB1 knockdown group, the mRNA levels of cycling D1 were sig- nificantly decreased (Figure 3A) and the protein expression levels of cycling D1 were also downregulated (Figure 3B), compared to the control group. In addition, the expression lev- els of cycling D1 were not affected by adding Ang II. These results suggest that CTNNB1 knockdown inhibits cell prolifera- tion through reducing expression of cycling D1.
CTNNB1 Knockdown Decreased Aldosterone Secretion in H295 R Cells
Cytochrome P450 family 11 subfamily B member 2 (CYP11B2) is one of the rate-limiting enzymes for aldosterone synthesis and is also the terminal enzyme. In order to explore the effect of CTNNB1 on aldosterone secretion, we detected the basal and Ang II-treated CYP11B2 expression levels. CTNNB1 knockdown inhibited the mRNA and protein expression levels of CYP11B2 (Figure 4A and C), but not the expression levels of CYP11B1 (Figure 4B and C). In addition, Ang II significantly increased the expression levels of CYP11B2 in H295 R cells, which was reversed by CTNNB1 knockdown (Figure 4A and C). On the contrary, Ang II also increased the expression levels of CYP11B1, which was not influenced by CTNNB1 knock- down (Figure 4B and C). Moreover, aldosterone ELISA Kit was used to detect the concentration of aldosterone in the supernatant of H295 R cells. We found that Ang II-induced upregulation of aldosterone secretion was reversed by CTNNB1
A
1.5
Relative mRNA expression (Folds)
1.0
*
*
ß-catenin
0.5
GAPDH
Control
si-01
si-02
si-03
0.0
Control
si-01
si-02
si-03
B
C
1.5
ß-catenin
Relative mRNA expression (Folds)
0.8
**
Relative cell viability
0.6
1.0
0.4
0.5
0.2
0.0
Control
si-ß-catenin
Control+AngII
si-ß-catenin+AngII
0.0
Control
si-ß-catenin
D
100
Colony formation rate (%)
80
**
60
40
20
0
Control
si-ß-catenin
Control
si-ß-catenin
knockdown (Figure 4D). These results suggest that CTNNB1 knockdown reduces the responses of H295 R cells to Ang II and decreases secretion of aldosterone.
Discussion
Hypertension is one of the most common cardiovascular dis- eases in China.19 In recent years, with the clinical application of plasma aldosterone/renin activity ratio (ARR) and the exten- sive application of computed tomography, magnetic resonance
imaging and other imaging technologies, the detection rate of PA in hypertensive population has been significantly improved. PA has become the common cause of intractable hypertension. In addition, the tissues in the heart, brain and kidneys in PA patients were more seriously damaged than those in PH patients, which results in more grievous consequences.3 Therefore, exploring novel therapeutic targets is an urgent and promising undertaking for the clinical treatment of PA.
Aldosterone production is stimulated by Ang II or extra- cellular K+ and is mediated mainly by Ca2+ influx into
A
AXIN2
B
Relative mRNA expression (Folds)
1.5
Relative mRNA expression (Folds)
1.5
LEF1
**
1.0
**
1.0-
**
0.5
0.5
0.0
Control
si-ß-catenin
Control+Ang II
si-ß-catenin+Ang II
0.0
Control
si-ß-catenin
Control+AngII
si-ß-catenin+AngII
C
ß-catenin
AXIN2
LEF1
GAPDH
Control
si-ß-catenin
Control+AngII
si-ß-catenin+AngII
adrenal glomerulosa cells through calcium signaling path- way.18,20 During the past years, significant progress has been made in the knowledge of the genetic basis of APA develop- ment. The mutation site of APA is related to the specific biochemical and clinical features of PA. Over 50% of APA patients have been identified to have multiple gene mutation sites, such as KCNJ5, CACNA1D, ATP1A1, and ATP2B3 mutations, which belong to cell membrane ion channel pro- tein encoding gene.21 These mutations may increase intracel- lular calcium concentrations through various ways, opening voltage-dependent calcium channels, thereby activating cal- cium signaling and aldosterone secretion.22 However, there are no obvious association between these mutations and adre- nal tumorigenesis.
Most majorities of APA patients have been detected to pos- sess activation of Wnt/ß-catenin signal pathway.23 In adrenal tumors, the main cause for activation of Wnt/ß-catenin signal pathway is CTNNB1 mutation.13 Patients with CTNNB1 muta- tion have larger adenomas size, but not higher level of aldos- terone, compared to the patients with other mutations.17,24
H295 R cells have been shown to be an Ang II-responsive steroid-producing adrenocortical cell line.25 Gaujoux et al has reported that silencing CTNNB1 can inhibit cell proliferation and stimulate apoptosis of H295 R through decreasing Wnt/B- catenin-LEF/TCF dependent transcription,14 but the relation- ship between Wnt/B-catenin signaling and Ang II-induced aldosterone secretion is unclear. In the present study, the secre- tion of aldosterone and the expression of rate-limiting enzyme gene CYP11B1 and CYP11B2 were increased by Ang II, and the silencing CTNNB1 inhibited aldosterone secretion and the expression of CYP11B2 but not CYP11B1 in H295 R cells. Furthermore, the expression of CYP11B2 and aldosterone secretion of H295 R cells in response to Ang II were both decreased by CTNNB1 knockdown, but CTNNB1 knockdown had no effect on expression of CYP11B1. These results sug- gested that silencing CTNNB1 genes reduced aldosterone secretion and responsiveness to Ang II of H295 R cells by inhibiting the expression of CYP11B2.
In addition, the relationship between CTNNB1 knockdown and H295 R cell proliferation in response to Ang II was also
A
CyclinD1
B
Relative mRNA expression (Folds)
1.5
**
**
ß-catenin
1.0
CyclinD1
0.5-
GAPDH
Control
si-ß-catenin+AngII
0.0
Control
si-ß-catenin
Control+AngII
si-ß-catenin+AngII
si-ß-catenin
Control+AngII
A
Relative mRNA expression (Folds)
3
CYP11B1
B
3
CYP11B2
ns
Relative mRNA expression (Folds)
2.
2
ns
1
1
0
Control
si-ß-catenin
Control+AngII
si-ß-catenin+AngII
0
Control
si-ß-catenin
Control+AngII
si-ß-catenin+AngII
C
D
100
ß-catenin
Aldosteronc expression (ng/ml)
80
CYP11B2
60
*
CYP11B1
40
20
GAPDH
Control
si-ß-catenin
Control+AngII
si-ß-catenin+AngII
0
Control
si-ß-catenin
Control+Ang II
si-ß-catenin+Ang II
investigated. Our results showed that CTNNB1 knockdown decreased expression of ß-catenin and inhibited proliferation of H295 R cells. Moreover, the downstream target genes of Wnt/B-catenin signaling pathway, AXIN2 and LEF1, were downregulated by CTNNB1 knockdown in H295 R cells, which
were consistent with Gaujoux et al.14 However, there was no difference in the Wnt/B-catenin signaling pathway of H295 R cells after Ang II treatment. These results indicate that the activation of Wnt/B-catenin signal pathway promoted APA tumorigenesis, which was independent of Ang II.
Uncontrolled cell proliferation is the most important hall- marks of cancer cells. Abnormal progression of cell cycle is the leading reason for dysregulation of cell proliferation. Cell cycle is regulated by a coordination of several cyclins and cell cycle inhibitors.26 Different cyclins are involved in different cell cycle stages. Cyclin D1 is a key protein that drives G1/S transi- tion of the cell cycle.27 In our study, expression of cyclin D1 was investigated in H295 R cells. The protein and mRNA levels of cyclin D1 were significantly reduced by CTNNB1 knockdown. These results suggest that CTNNB1 knockdown downregulates cyclin D1 expression to inhibit H295 R cell proliferation.
In conclusion, our findings suggest that CTNNB1 knock- down can inhibit H295 R cell proliferation and decrease aldos- terone secretion in the responses of H295 R cells to Ang II through inhibiting Wnt/B-catenin signaling pathway, indicating that targeting Wnt/B-catenin signaling pathway may be an important approach to decrease aldosterone secretion in the treatment of aldoster-producing adenomas.
Authors’ Contributions
P.L and T.Z conducted the study design; P.L and L.W carried out experiments, data analysis and wrote the manuscript; S.Y, J.L, S.Q and Z.W provided the technical or material support. All authors read and approved the final manuscript.
Tingting Zhou, MM Pengwei Luo, MM are authors contributed equally to this work.
Availability of Data and Material
The datasets used and/or analyzed during the current study are avail- able from the corresponding author on reasonable request.
Declaration of Conflicting Interests
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The present study was supported by the foundation of Western Theater General Hospital (41732C11X).
ORCID iD
Tingting Zhou ® https://orcid.org/0000-0001-9568-4094
References
1. Douma S, Petidis K, Doumas M, et al. Prevalence of primary hyperaldosteronism in resistant hypertension: a retrospective observational study. Lancet. 2008;371(9628):1921-1926. doi:10. 1016/S0140-6736(08)60834-X PubMed PMID: 18539224.
2. Young WF. Primary aldosteronism: renaissance of a syndrome. Clinical Endocrinol(Oxf). 2007;66(5):607-618. Epub 2007/05/12. doi:10.1111/j.1365-2265.2007.02775.x PubMed PMID: 17492946.
3. Milliez P, Girerd X, Plouin PF, Blacher J, Safar ME, Mourad JJ. Evidence for an increased rate of cardiovascular events in patients with primary aldosteronism. J Am Coll Cardiol. 2005;45(8):
1243-1248. doi:10.1016/j.jacc.2005.01.015. PubMed PMID: 15837256.
4. Hannemann A, Bidlingmaier M, Friedrich N, et al. Screening for primary aldosteronism in hypertensive subjects: results from two German epidemiological studies. Eur J Endocrinol. 2012;167(1): 7-15. doi:10.1530/EJE-11-1013 PubMed PMID: 22495491.
5. Fagugli RM, Taglioni C. Changes in the perceived epidemiology of primary hyperaldosteronism. Int J Hypertens. 2011;2011: 162804. doi:10.4061/2011/162804 PubMed PMID: 21837271; PubMed Central PMCID: PMCPMC3151507.
6. Mysliwiec J, Gorska M. Primary aldosteronism: a common and important problem. A practical guide to the diagnosis and treat- ment. Endokrynol Pol. 2012;63(4):324-336. PubMed PMID: 22933170.
7. Steichen O, Zinzindohoue F, Plouin PF, Amar L. Outcomes of adrenalectomy in patients with unilateral primary aldosteronism: a review. Horm Metab Res. 2012;44(3):221-227. doi:10.1055/s- 0031-1299681 PubMed PMID: 22395801.
8. MacDonald BT, Tamai K, He X. Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell. 2009;17(1): 9-26. doi:10.1016/j.devcel.2009.06.016 PubMed PMID: 19619488; PubMed Central PMCID: PMCPMC2861485.
9. Holland JD, Klaus A, Garratt AN, Birchmeier W. Wnt signaling in stem and cancer stem cells. Curr Opin Cell Biol. 2013;25(2): 254-264. doi:10.1016/j.ceb.2013.01.004 PubMed PMID: 233 47562.
10. Maschietto M, de Camargo B, Brentani H, et al. Molecular profil- ing of isolated histological components of Wilms tumor impli- cates a common role for the Wnt signaling pathway in kidney and tumor development. Oncology. 2008;75(1-2):81-91. doi:10.1159/ 000155210 PubMed PMID: 18784435.
11. Sharma A, Sen JM. Molecular basis for the tissue specificity of beta-catenin oncogenesis. Oncogene. 2013;32(15):1901-1909. Epub 2012/06/13. doi:10.1038/onc.2012.215 PubMed PMID: 22689057; PubMed Central PMCID: PMCPMC3534820.
12. Clevers H, Nusse R. Wnt/beta-catenin signaling and disease. Cell. 2012;149(6):1192-1205. doi:10.1016/j.cell.2012.05.012 PubMed PMID: 22682243.
13. Akerstrom T, Maharjan R, Sven Willenberg H, et al. Activating mutations in CTNNB1 in aldosterone producing adenomas. Sci Rep. 2016;6:19546. doi:10.1038/srep19546 PubMed PMID: 26815163; PubMed Central PMCID: PMCPMC4728393.
14. Gaujoux S, Hantel C, Launay P, et al. Silencing mutated ß-catenin inhibits cell proliferation and stimulates apoptosis in the adreno- cortical cancer cell line H295 R. PloS One. 2013;8(2):e55743. Epub 2013/02/15. doi:10.1371/journal.pone.0055743 PubMed PMID: 23409032; PubMed Central PMCID: PMCPMC3567123.
15. Berthon A, Sahut-Barnola I, Lambert-Langlais S, et al. Constitu- tive beta-catenin activation induces adrenal hyperplasia and pro- motes adrenal cancer development. Hum Mol Genet. 2010;19(8): 1561-1576. doi:10.1093/hmg/ddq029 PubMed PMID: 20106872.
16. Heaton JH, Wood MA, Kim AC, et al. Progression to adrenocor- tical tumorigenesis in mice and humans through insulin-like growth factor 2 and ß-catenin. Am J pathol. 2012;181(3): 1017-1033. Epub 2012/07/18. doi:10.1016/j.ajpath.2012.05.026
PubMed PMID: 22800756; PubMed Central PMCID: PMCPMC3432433.
17. Wu VC, Wang SM, Chueh SJ, et al. The prevalence of CTNNB1 mutations in primary aldosteronism and consequences for clinical outcomes. Sci Rep. 2017;7:39121. doi:10.1038/srep39121 PubMed PMID: 28102204; PubMed Central PMCID: PMCPMC5244399.
18. Yamashiro T, Kuge H, Zhang J, Honke K. Calcineurin mediates the angiotensin II-induced aldosterone synthesis in the adrenal glands by up-regulation of transcription of the CYP11B2 gene. J Biochem. 2010;148(1):115-123. doi:10.1093/jb/mvq037
19. Yang C, Wang J, Gao B, et al. Prevalence and treatment of hypertension in China: impacts of 2017 American College of Cardiology/American Heart Association high blood pressure guideline. Sci Bull. 2018;63(8):34-39. doi:CNKI: SUN: JXTW. 0.2018-08-007
20. Bayliss DA, Barrett PQ. Emerging roles for two-pore-domain potassium channels and their potential therapeutic impact. Trends pharmacol sci. 2008;29(11):566-575. Epub 2008/10/01. doi:10. 1016/j.tips.2008.07.013 PubMed PMID: 18823665; PubMed Central PMCID: PMCPMC2777628.
21. Fernandes-Rosa FL, Williams TA, Riester A, et al. Genetic spec- trum and clinical correlates of somatic mutations in aldosterone- producing adenoma. Hypertension. 2014;64(2):354-361. doi:10. 1161/HYPERTENSIONAHA.114.03419 PubMed PMID: 24866132.
22. Condon JC, Pezzi V, Drummond BM, Yin S, Rainey WE. Calmodulin-dependent kinase I regulates adrenal cell expression of aldosterone synthase. Endocrinology. 2002;143(9):3651-3657. doi:10.1210/en.2001-211359 PubMed PMID: 12193581.
23. Berthon A, Drelon C, Ragazzon B, et al. WNT/beta-catenin sig- nalling is activated in aldosterone-producing adenomas and con- trols aldosterone production. Hum Mol Genet. 2014;23(4): 889-905. Epub 2013/10/03. doi:10.1093/hmg/ddt484 PubMed PMID: 24087794.
24. Morin PJ, Sparks AB, Korinek V, et al. Activation of beta- catenin-Tcf signaling in colon cancer by mutations in beta- catenin or APC. Science. 1997;275(5307):1787-1790. Epub 1997/03/21. doi:10.1126/science.275.5307.1787 PubMed PMID: 9065402.
25. Romero DG, Welsh BL, Gomez-Sanchez EP, Yanes LL, Rilli S, Gomez-Sanchez CE. Angiotensin II-mediated protein kinase D activation stimulates aldosterone and cortisol secretion in H295 R human adrenocortical cells. Endocrinology. 2006;147(12): 6046-6055. Epub 2006/09/16. doi:10.1210/en.2006-0794 PubMed PMID: 16973724.
26. Galderisi U, Jori FP, Giordano A. Cell cycle regulation and neural differentiation. Oncogene. 2003;22(33):5208-5219. doi:10.1038/ sj.onc.1206558 PubMed PMID: 12910258.
27. Lim S, Kaldis P. Cdks, cyclins and CKIs: roles beyond cell cycle regulation. Development. 2013;140(15):3079-30793. Epub 2013/ 07/19. doi:10.1242/dev.091744 PubMed PMID: 23861057.