Detection of Ob-Receptor in Human Adrenal Neoplasms and Effect of Leptin on Adrenal Cell Proliferation
A. Glasow, S. R. Bornstein1, G. P. Chrousos 1, J. W. Brown2, W. A. Scherbaum 3
Department of Internal Medicine III, University of Leipzig, Leipzig, Germany
1 Developmental Endocrinology Branch, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, USA
2 Department of Medicine, University of Miami, School of Medicine
and U. S. Department of Veterans Affairs Medical Center, Miami, Florida, USA
3 Diabetes Research Institute, University of Düsseldorf, Düsseldorf, Germany
Leptin, a hormone mainly secreted from adipose tissue, communicates a metabolic signal to the adrenal gland. Ob-Re- ceptor (Ob-R) expression was reported in rat, mice and human adrenal glands. This study intended to investigate possible dif- ferences in the Ob-R expression and distribution of Ob-R pro- tein in human adrenal tumors as compared to normal adrenal tissue. Proliferative effects of leptin were analyzed in the hu- man adrenocortical carcinoma cell line (NCI-H295). The full length Ob-R mRNA and the isoforms B219.1 and B219.3 could be demonstrated by RT-PCR in all adrenal tumors (n=8), the tumor cell line (NCI-H295) and normal tissue. In contrast the Ob-R isoform B219.2 was absent in the carcinoma cell line and in most of the adrenal tumors (n = 5), whereas it was present in normal adrenals. The Ob-R protein could be demonstrated in benign and malignant adrenocortical tumors. Pheochromocy- tomas showed only a weak immunostaining with the human Ob-R antibody. Human leptin did not affect the proliferation or variability of adrenal tumor cells as demonstrated by [3H]-thy- midine assay and WST-1 test. In conclusion, although functional leptin receptors are expressed in human adrenal tumors, leptin does not regulate tumor cell proliferation.
Key words: Immunostaining - Leptin Receptor - Adrenal Pathologies
Introduction
Leptin, the product of the obese gene, regulates metabolic rate by several mechanisms, including changes in the hypothala- mic-pituitary-adrenal (HPA) axis [1]. There is a clear reciprocal relation between the diurnal secretion of leptin and the activ- ity of the HPA axis in both rodents and humans [2]. High doses of synthetic glucocorticoids increase expression and secretion of leptin in vivo in humans [3,4] whereas leptin suppresses the stress induced activation of the HPA axis.
While the expression of Ob-Rs has been detected in a variety of human tissues, the presence of Ob-R protein has been shown hitherto only in the brain and in normal adrenal tissues [5,6]. Consistent with these findings leptin inhibits the HPA axis
both at the central and peripheral level through its functional receptors [2,6,7].
So far nothing is known about Ob-R distribution and action in adrenal tumors. However the Ob-R was shown to mediate ef- fects on cell proliferation in mice [8 - 12]. Therefore we inves- tigated in this study a potential role of leptin in human adrenal tumors by 1) comparing the Ob-R protein distribution and the expression of the Ob-R isoforms [13] in adrenal tumors with normal adrenal tissue and 2) analyzing effects of leptin on cell growth and mitosis of adrenal tumor cells.
Materials and Methods
Materials
Specimens from 16 patients (32-60 yrs) with adrenal tumors (2 funtioning and 5 non-functioning adrenocortical adenomas, 7 adrenocortical carcinomas and 2 phaechromocytomas) and 8 normal adrenals were analyzed in this study. The paraffin em- bedded tumorous tissues were kindly provided by Prof. S. Schröder (Hamburg, Germany) and Prof. L. Fishman (Miami, Fl, USA). The human adrenocortical carcinoma cell line NCI- H295 was purchased from ATCC (Rockville, MD, USA). Unless otherwise indicated, all reagents were purchased from Sigma Chemical Company (München, Germany).
Immunohistochemical procedures
Immunostaining was performed by the labeled streptavidin- biotin-technique (LSAB, DAKO, Hamburg, Germany) as pre- viously described [6]. To detect the full length leptin receptor we used a 1:50 dilution of the polyclonal goat anti human Ob-R antibody in a dilution 1:50 (C-20, sc-1832, Santa Cruz Biotechnology, Santa Cruz, USA). This antibody is raised against a peptide corresponding to amino acids 1146-1165 mapping the carboxy terminus of the full length Ob-R. For neg- ative control, primary antibody was preabsorbed with ten times surplus of the control peptide (sc-1832 P, Santa Cruz Bio- technology) or was replaced by goat IgG (Santa Cruz Biotech- nology). No unspecific staining occurred in these controls.
Proliferation and viability assays
NCI-H295 adrenocortical carcinoma cells were maintained in RPMI 1640 medium (Gibco BRL, Eggenstein, Germany) con- taining hydrocortisone (3.625 µg/1), insulin (5 mg/l), apo- transferrin (100 mg/l), estradiol (2.724 µg/l), selenite (5 µg/ ml), 2% fetal calf serum, and penicillin/streptomycin (100 U/ ml). All cells were grown in a humidified atmosphere of 5% CO2/95% air at 37 ℃ in routinely changed media.
The effect of leptin on the viability of adrenal cells was studied using the WST-1 assay (Boehringer, Mannheim, Germany). The assay principle is based on tetrazolium salts that are cleaved to formazan by mitochondrial dehydrogenases only in viable cells. An expansion in the number of viable cells results in an increase in the overall activity of these dehydrogenases lead- ing to an increase in the amount of formazan dye formed. For WST-1 cells (250 000 cells/well, 24-well plates) were incubat- ed with leptin (100-1000 ng/ml, TEBU, Frankfurt, Germany) or ACTH (10-7 M, Synacthen, Ciba Geigy, Wehr, Germany) in se- rum free medium containing ascorbic acid (20 mg/l), apo- transferrin (100 mg/ml), BSA (0.01%, wt/vol), and bacitracin (0.01 %, wt/vol) for 24 h. After this period, 10% (vol/vol) WST-1 reagent was added and absorbance was measured at 450 nm after 50 min.
To assess cell growth by [3H]-thymidine assay, NCI-H295 sus- pension cells (105 cells/well, 96-well plates, Greiner Labor- technik, Frickenhausen, Germany) were cultured in the pres- ence of 2.5 uCi/ml of [3H]-thymidine (Peninsula, Belmont, Ca- lif., USA) and leptin (100-1000 ng/ml) for 24 h. Controls were cultured without leptin. Shorter incubation invertals (3, 10, 16 h) were tested. However, the longest exposure time to thy- midine employed gave the best results, because of the low pro- liferation rate of these cells. The serum concentration of the medium was varied between 0.01 % and 2% BSA but did not in- fluence the basal cell proliferation. Cells were harvested with an automated cell harvester (Filtermate 196, Packard GmbH, Meriden). After drying the filter with the harvested cells at 60℃ for 1 h they were covered with a scintillator sheet and the [3H]-thymidine uptake was measured on a ß-counter (Ma- trix TM 9600, Packard GmbH, Meriden). In both tests the ad- equate inhibition of adrenal cell proliferation to about 80% by corticotropin (10-9 M) served as a quality control [14].
RNA isolation and RT-PCR
Total RNA was isolated from 2 x 106 cultured cells or 100 mg adrenal tissue using RNeasy-kit (Quiagen, Hilden, Germany) as described previously [6]. PCR was performed in a GeneAmp 9600 thermal cycler (Perkin-Elmer, Überlingen, Germany) using intron spanning primer pairs. The cDNA was amplified in 20 ul containing 1 x PCR buffer with 1.5 mM MgCl, 200 uM deoxy-NTPs, 10 pmol each of forward and reversed primers and 0.5 U of Expand High fidelity polymerase (Boehringer). Primers, PCR conditions and controls to detect the full length Ob-R and the Ob-R isoforms were used as previously described [6], if not otherwise indicated. To detect the Ob-R isoform B219.1 optimized primers (GB: HSU52912 5’→3’, F: ATT- CAATTGGTGCTTCTGTT, R: AGCAGATAAACAAGTGAACAAAG) were employed, PCR conditions were as follows: an initial de- naturation step at 94 ℃, 2 min, was followed by 36 cycles: de- naturation at 94 ℃ for 30 sec, annealing at 56 ℃, 30 sec, elon-
gation at 72 °℃ for 60 sec and a prolonged final elongation step at 72℃. In all PCR experiments, control amplification in the absence of cDNA was performed. After electrophoresis through a 1.5% agarose gel PCR products were visualized by ethidium bromide staining and their length was estimated by a 100 bp ladder (Boehringer). The identity of PCR products was proved by sequencing on an Alf sequencer (Pharmacia, Germany). Ex- periments were reproduced with cDNAs from eight adrenal tu- mors and three different RNA isolations from the NCI-H295 cell line.
Statistical analysis
Results are expressed as the mean + SD. Statistical significance was determined by Student’s t-test, unpaired, using the soft- ware package SPSS for Windows, Version 6.0. Experiments were repeated at least three times (n) using quadruplicates for proliferation assays.
Results
Localization of the Ob-R: Immunohistochemistry
Using a polyclonal antibody against the human full length Ob- R, positive immunoreactivity was observed in each of the five adenomas and seven carcinomas examined (Fig. 1 b, c). The im- munoreactivity was located in the cytoplasm of the adrenal cells but not in nuclei. The mixed cell adenoma (Fig. 1b) con- tains fasciculata like, clear cells and cells with dense cytoplas- ma of the reticularis like type. The fasciculata like cells ap- peared lighter and more weakly stained than the cells of reti- cularis like type resulting from their higher content of lipids. This phenomenon has been observed also with other antibo- dies, directed against cortical proteins, and does not seem to reflect different receptor concentrations on these cells (unpub- lished observations). In human pheochromocytoma, a much weaker immunoreactivity was found in the medullary tumor cells than in the surrounding cortical cells, which strongly stained for the Ob-R (Fig. 1d). In comparison with normal adrenals (Fig. 1 a) [6], adrenal pathologies revealed no signifi- cant differences in the localization and staining intensity of the Ob-R.
Expression of the Ob-R mRNA: RT-PCR
The expression of full length Ob-R and isoforms B219.1 and 3 could be detected in each of the investigated adrenal carcino- mas and adenomas. The Ob-R B219.2 isoform seems to be expressed to a lesser amount and was found only in three of eight tumors. Likewise the adrenocortical carcinoma cell line NCI-H295 cell line expressed all forms of the Ob-R, apart from the B219.2 isoform (Fig. 2a-d).
Cell viability and proliferation experiments
By the proliferation assay (WST-1 test) was proved that leptin had no influence on the viability and proliferation rate of NCI- H295 cells and on normal adrenal cells in primary culture (Fig. 3). After treatment with leptin, the adsorbance in the NCI-H295 cell line (leptin 100 ng/ml: 0.3437 + 0.057, n = 3, lep- tin 1000 ng/ml: 0.312 ±0.008, n = 1) was not significantly dif- ferent from the basal adsorbance of 0.336 ±0.049, n = 3. The same result was found in normal human adrenal cells in pri-
A
B
C
D
mary culture (basal adsorbance: 0.453 +0.059, leptin 100 ng/ ml 0.459 ± 0.054, n =2) [6].
These observations were confirmed by the [3H]-thymidine in- corporation assay. In the NCI-H295 cell line, mean basal levels of 21931 ± 2623 cpm were detected. After incubation with lep- tin 100 ng/ml or 1000 ng/ml, values of 20271 + 2736 cpm and 23 160 ± 2180 cpm were measured respectively.
Discussion
In the present study we demonstrate the presence of long form Ob-R in adrenal adenomas, carcinomas and pheochromocyto- mas.
Previously it has been shown, that leptin can influence steroi- dogenesis in vitro in the normal human adrenal via Ob-Rs
expressed in human adrenocortical cells [6,7]. Furthermore, Ob-R expression and action of leptin on steroidogenesis were described in the adrenal gland of rats [7,15,16]. Effects of leptin on adrenal sympathetic system have been suggested [17], however studies from our laboratory did not show any direct influence of leptin on the catecholamine secretion of human adrenal cells in primary cell culture [6]. In addition to the reg- ulation of hormone secretion, the expression of functional lep- tin receptors in adrenal tissue may have other functions.
Overexpression of eutopic or expression of ectopic receptors have been recently implicated in the pathogenesis of adrenal adenomas [18,19]. On the other hand, cells that undergo dedif- ferentiation often show downregulation of receptors [20]. In the neoplasms investigated there was no change in the stain- ing pattern versus normal tissue which would be indicative for an involvement of leptin in tumorigenesis. We did not find
A
B
344 bp-
-657 bp
Ob-R
Ob-R219.1
C
D
772 bp-
-573 bp
Ob-R219.2
Ob-R219.3
AD
CA
NCI
C
M
AD
CA
NCI
C
M
0.60
adsorbance [450 nm]
0.50
0.40
0.30
0.20
0.10
0.00
basal lep 100 ng/ml
NCI-H295
basal lep 100 ng/ml
HAC
any differences in the length of PCR-products or additional splicing variants and could demonstrate expression of the Ob- R isoforms B219.1 and 3 and the full length receptor in each of the investigated adrenal pathologies and in the NCI-H295 cell line. Consistent with observations in human fetal liver [13] and normal adrenal cells the Ob-R B219.2 isoform was shown to be expressed to a lesser extent than the other Ob-Rs and was not found in NCI-H295 cells. The Ob-R belonging to the class I cy- tokine receptor superfamily [21] was shown to mediate effects on cell proliferation via mitogen-activated protein kinase (MAPK) [8] and janus kinase 2 (JAK 2) pathway [9] and it may therefore be involved in cell turnover and tissue homeostasis of the adrenal cortex. In this study the influence of leptin on cancer cell proliferation was investigated using the NCI-H295 cell line by the viability and proliferation tests WST-1 and [3H]-thymidine assay. Consistent with recent findings in nor- mal adrenal cells [6] incubation with leptin (100 and 1000 ng/ ml) failed to induce mitogenesis or differences of the viability in the NCI-H295 cells. Although in pancreatic and hematopoe- tic murine cells mitogenic effects of leptin were reported [8- 12] our data on human adrenal cells and carcinomas do not support a role of leptin in proliferative processes of adrenal cells.
In conclusion: 1) long form leptin receptors are present in both benign and malignant adrenal tumors, 2) leptin inhibits adre- nal steroidogenesis but does not affect adrenal cell prolifera- tion.
Acknowledgements
This work was supported by a grant of DFG, SFB 351, project C8 Düsseldorf (to W.A.S. and S.R.B.) and a Heisenberg Grant BO 1141 6-1 (to S.R.B.). We thank Silke Brauer and Sandy Laue for their excellent technical assistance.
References
1. Campfield LA, Smith FJ, Burn P. The ob protein (leptin) pathway - a link between adipose tissue mass and central neural net- works. Horm Metab Res 1996; 28: 619-32
2. Flier JS. What’s in a name? In search of leptin’s physiologic role. J Clin Endocrinol Metab 1998; 83: 1407- 13
3. Miell JP, Englaro P, Blum WF. Dexamethasone induces an acute and sustained rise in circulating leptin levels in normal human subjects. Horm Metab Res 1996; 28: 704-7
4. Papaspyrou-Rao S, Schneider SH, Petersen RN, Fried SK. Dexa- methasone increases leptin expression in humans in vivo. J Clin Endocrinol Metab 1997; 82: 1635-7
5. Couce ME, Burguera B, Parisi JE, Jensen MD, Lloyd RV. Localiza- tion of leptin receptor in the human brain. Neuroendocrinology 1997; 66: 145-50
6. Glasow A, Haidan A, Hilbers U, Breidert M, Gillespie J, Scher- baum WA, Chrousos GP, Bornstein SR. Expression of ob receptor in normal human adrenals: differential regulation of adrenocor- tical and adrenomedullary function by leptin. J Clin Endocrinol Metab 1998; 83: 4459-66
7. Pralong FP, Roduit R, Gerhard W, Castillo E, Mosimann F, Tho- rens B, Gaillard RC. Leptin inhibits directly glucocorticoid secre- tion by normal human and rat adrenal gland. Endocrinol 1998; 139: 4264-8
8. Takahashi Y, Okimura Y, Mizuno I, Iida K, Takahashi T, Kaji H, Abe H, Chihara K. Leptin induces mitogen-activated protein ki- nase-dependent proliferation of c3h10t1/2 cells. J Biol Chem 1997; 272: 12 897 - 900
9. Ghilardi N, Skoda RC. The leptin receptor activates janus kinase 2 and signals for proliferation in a factor-dependenet cell line. Mol Endocrinol 1997; 11: 393-9
10. Umemoto Y, Tsuji K, Yang FC, Ebihara Y, Kaneko A, Furukawa S, Nakahata T. Leptin stimulates the proliferation of murine mye- locytic and primitive hematopoietic progenitor cells. Blood 1997; 90: 3438 - 43
11. Tanabe K, Okuya S, Tanizawa Y, Matsutani A, Oka Y. Leptin in- duces proliferation of pancreatic beta cell line min6 through ac- tivation of mitogen-activated protein kinase. Biochem Biophys Res Commun 1997; 241: 765-8
12. Gainsford T, Willson TA, Metcalf D, Handman E, McFarlane C, Ng A, Nicola NA, Alexander WS, Hilton DJ. Leptin can induce pro- liferation, differentiation, and functional activation of hemo- poietic cells. Proc Natl Acad Sci USA 1996; 93: 14564-8
13. Cioffi JA, Shafer AW, Zupancic TJ, Smith-Gbur J, Mikhail A, Plati- ka D, Snodgrass HR. Novel b219/ob receptor isoforms: possible role of leptin in hematopoiesis and reproduction. Nat Med 1996; 2: 585-9
14. Hornsby PJ, Gill GN. Desensitization to ACTH and interaction between ACTH and fibroblast growth factor in bovine adreno- cortical cell cultures. J Clin Invest 1977; 60: 348-50
15. Cao GY, Considine RV, Lynn RB. Leptin receptors in the adrenal medulla of the rat. Am J Physiol 1997; 273: E448 - E452
16. Malendowicz LK, Nussdorfer GG, Markowska A. Effects of re- combinant murine leptin on steroid secretion of dispersed rat adrenocortical cells. J Steroid Biochem Mol Biol 1997; 63: 123-5
17. Haynes WG, Sivitz WI, Morgan DA, Walsh SA, Mark AL. Sympa- thetic and cardiorenal actions of leptin. Hypertension 1997; 30: 619-23
18. Lacroix A, Bolté E, Tremblay J, Dupré J, Poitras P, Fournier H, Gar- on J, Garrel D, Bayard F, Taillefer R, Flanagan RJ, Hamet P. Gastric inhibitory polypeptide-dependent cortisol hypersecretion- a new cause of Cushing’s syndrome. N Engl J Med 1992; 327: 973-80
19. Willenberg HS, Stratakis CA, Marx C, EhrhartBornstein M, Chrousos GP, Bornstein SR. Aberrant interleukin-1 receptor ex- pression in a cortisol-secreting adenoma causing Cushing’s syn- drome. N Engl J Med 1998; 339: 27- 31
20. Opocher G, Rocco S, Cimolato M, Vianello B, Arnaldi G, Mantero F. Angiotensin II receptors in cortical and medullary adrenal tu- mors. J Clin Endocrinol Metab 1997; 82: 865-9
21. White DW, Kuropatwinski KK, Devos R, Baumann H, Tartaglia LA. Leptin receptor (ob-r) signaling. Cytoplasmic domain muta- tional analysis and evidence for receptor homo-oligomeriza- tion. J Biol Chem 1997; 272: 4065-71
Requests for reprints should be addressed to:
A. Glasow Medizinische Klinik und Poliklinik III University of Leipzig Philipp-Rosenthal-Strasse 27 04103 Leipzig Germany
| Phone: | + 49 (341) 9713318 |
| Fax: | + 49 (341) 9713219 |
| E-mail: | glasowa@medizin.uni-leipzig.de |
Downloaded by: East Carolina University. Copyrighted material.