ORIGINAL ARTICLE
Expression of growth hormone-releasing hormone receptor splicing variants in human primary adrenocortical tumours
Simona Freddi*, Giorgio Arnaldi*, Francesca Faziolit, Marina Scarpelli+, Gloria Appolloni*, Tatiana Mancini*, Blerina Kola*, Xavier Bertagna§, Franco Manterol, Robert Collu* and Marco Boscaro*
*Division of Endocrinology and +Laboratory of Cellular and Molecular Biology, Institute of Clinical Medicine and Applied Biotechnology, Section of Pathological Anatomy and Histopathology, Department of Neurosciences. Polytechnic University of the Marche Region, Ancona, Italy, §Department of Endocrinology, Institut Cochin, Institut National de la Santè et de la Recherche Medical U576, Rene Descartes-Paris V University, Paris, France and §Division of Endocrinology, Institute of Internal Medicine, Padova, Italy
Summary
Objective Several splice variants (SVs) of GHRH receptor (GHRH-R) have been identified in various human cancers through which GHRH antagonists may exert their IGF-II-mediated antiproliferative action. Because the overexpression of the IGF-II gene is a frequent feature of adrenal carcinoma, we searched for the presence of GHRH-R SVs in these tumours.
Methods and Results The expression of GHRH-R SVs was assessed by nested PCR in 45 human adrenocortical tumours. We have amplified 720-, 566- and 335-bp PCR products only in carcinomas. Their sequence revealed three open reading frames, corresponding to SV1, SV2 and SV4 of GHRH-R. SV2 was detected in five of 24 cancers examined, whereas the incidence of SV1 and SV4 was lower. Their simultaneous expression was observed in one carcinoma. No PCR products for SV3 or wild-type GHRH-R were found in carcinomas; mRNA for wild-type GHRH-R or SVs of GHRH- R were not observed either in adenomas or in normal adrenal or in NCI-H295R cells. Interestingly, all carcinomas which expressed SVs were also positive for the presence of GHRH mRNA.
Conclusion This is the first time that the expression of splice variants of GHRH-R has been demonstrated in human adrenal carcinoma. This study raises the possibility that splice variants might play a role in adrenal carcinogenesis and might offer the possibility for new therapeutic strategies at least in a subgroup of adrenal carcinomas.
(Received 30 June 2004; returned for revision 9 August 2004; finally revised 9 October 2004; accepted 7 February 2005)
Correspondence: Dr Giorgio Arnaldi, Clinica di Endocrinologia, Azienda Ospedaliera-Universitaria, Ospedali Riuniti di Ancona, Via Conca, 60020 Ancona, Italy. Tel: +39-071-887061; Fax: +39-071-887300; E-mail: g.arnaldi@ao-umbertoprimo.marche.it
Introduction
New approaches have been tried in the last few years to gain a better knowledge of the biology of adrenortical tumours, to identify new markers of invasiveness/malignancy and to explore the potential for the development of novel therapeutic strategies.” Recently, potent antagonistic analogues of GHRH have been synthesized and assessed for treatment of various human cancers.24 These GHRH antagonists strongly suppress the in vivo growth of experimental carcinomas from prostate,5-8 breast,9 ovary10 kidney,11 lung (either small cell or nonsmall cell),12-14 pancreas6,15 and colon.16 They also suppress the growth of bone sarcoma17 and glioblastoma.1
These antagonists may inhibit tumour proliferation in vivo by acting indirectly through the suppression of the GH/IGF-I axis19 but they also directly influence neoplastic cells. Actually, they show antiproliferative activity in in vitro cultures of various human cancer cell lines and suppress production of IGF-II, under conditions that clearly exclude indirect endocrine effects.5,10,13,15-18,20 Furthermore, the observation that tumoural concentrations of IGF-I and IGF-II decrease in various cancers treated in vivo with the antagonists, without significant effects on serum IGF-I, strongly suggests that GHRH antagonists may exert a direct effect on tumour growth. 19,21, Because the expression of the pituitary form of GHRH receptor (GHRH-R) has not been detected in any of the cancer models so far studied, it is reasonable to speculate that specific GHRH-R mediating the direct antiproliferative action of the antagonists should be present on tumour cells. Indeed, recent investiga- tions show that four splicing variants (SVs) of the GHRH-R23 are expressed in various human experimental cancers such as prostatic carcinomas.7,9-11,13,14,23-28 Among these SVs, SV1 differs from the GHRH-R, which is a G protein-coupled receptor with seven hydrophobic transmembrane domains, only in the extracellular domain where the first three exons have been replaced by a fragment of the third intron. SV2 and SV4 have the same variant extracellular domain as SV1 but, in addition, they have other exon deletions resulting in the loss of all transmembrane domains, intervening loops and C- terminus (SV4) and in the presence of only the first two transmembrane domains (SV2). Finally, SV3 protein, detected only in the normal prostate, is completly different from the wild-type GHRH-R.
Studies about the activity of SV2 and SV4 proteins have not been carried out, whereas SV1, predominantly detected in cancer models, is a functional isoform. Experimental studies with transfected cells suggest that this variant form is functional and relays mitogenic and other signals in a GHRH-dependent and -independent (when overexpressed) manner probably acting through IGF-I/IGF-II.29 Indeed, SV1 shows high-affinity binding for GHRH and GHRH antagonists.30 Therefore, this tumoural receptor might mediate the mitogenic action of GHRH produced locally in some human cancers;12,31 on the other hand, it might suppress cell proliferation when binding GHRH antagonists.
Very little is known about the structure and expression pattern of SVs in human primary tumours except for prostate cancer.32
Overexpression of the IGF-II gene is associated with the malignant phenotype in sporadic adrenocortical tumours, occurring in 90% of carcinomas.1,33 For this reason, we have investigated the expression of the GHRH-R SVs in a large series of 45 human adrenocortical tumours including 24 carcinomas, in normal adrenal glands and in the NCI-H295R human adrenocortical cancer cell line.
Materials and methods
Tissue samples
Forty-eight human adrenocortical tissue samples from patients who underwent surgical removal of their adrenal tumours are the object of this study. There were 10 aldosterone-producing adenomas (APA), 10 cortisol-producing adenomas (CPA), one androgen- producing adenoma (AnPA), 24 carcinomas (10 steroid-secreting and 14 nonsecreting tumours). Two pieces of normal adrenal tisssue obtained from peritumoral aldosterone-secreting adenomas, a liver metastasis from an adrenal carcinoma and a human adrenal cortical tumoural cell line were also included in the study. Furthermore, a sporadic phaeochromocytoma has been used as positive control of GHRH gene expression. All the samples were prospectively collected and stored at -80 ℃ until analysed. Informed consent was given for adrenal tissue collection and molecular studies.
Cell culture
NCI-H295R human adrenocortical carcinoma cell line was obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and was routinely grown in Dulbecco’s modified Eagle medium (DMEM)-F12 containing 2.5% NU-serum, 105 u/1 penicillin, 105 µ/1 streptomycin, 2 mM L-glutamine and 1% ITS + premix culture supple- ment (Insulin 6-25 mg/l, transferrin 6-25 mg/1, selenium 6-25 ng/1, bovine serum albumin 1.25 g/1, lineoleic acid 5-35 mg/1) at 37 ℃ in a humidified 95% air 5% carbon dioxide atmosphere. All tissue culture reagents were obtained from Invitrogen (Carlsbad, CA, USA) except NU-serum and the ITS + premix that were from BD Biosciences (Bedford, MA, USA).
RNA extraction
Total RNA was extracted by homogenization in Trizol Reagent (Invitrogen) while still frozen, followed by incubation at room
temperature with chloroform for approximately 5 min. Insoluble material was removed by centrifugation. Isolated total RNA was treated with DNAase-I (Ambion Inc., Austin, TX, USA) for 40 min at 37 ℃. The integrity of the RNA samples was determined by electrophoresis through denaturing agarose gel and by staining with ethidium bromide. The 18S and 28S ribosomal RNA bands were visualized under UV light. The yield of RNA was quantified spectrophotometrically at 260 nm and 260/280 ratio.
RT-PCR analysis
Reverse transcription of 1 µg RNA was performed in 50 mM KCI, 5 mM MgCl2, 25 mM Tris-HCl pH 8.3, 2 mm dithiotreitol, 4 U Avian Myeloblastosis Virus Reverse Transcriptase (AMV-RT; Finnzymes OY, Espoo, Finland), 1.5 ng/ul random hexamer mix (Invitrogen) and 0-25 mM each dNTPs (Invitrogen) in a volume of 20 ul. The samples were incubated at 70 ℃ for 10 min and 42 ℃ for 70 min. Thirty per cent of each RT reaction was used for PCR amplification with primer sets specific for human GHRH-R, or its SVs,23 and human GHRH.31 The quality of the RT reaction was always tested by PCR amplification of human ß-actin using a primers set spanning two introns34 (Table 1).
In the case of GHRH-R and its SVs a primary PCR amplification was made and 5 ul of the PCR product were used as DNA target for a nested PCR as previously described,23 while only a simple PCR amplification was made for GHRH. The reactions included 10 mM Tris-HCl pH 8-8, 50 mM KCI, 0-1% Triton X-100, 1 mm MgCl2, 0.3 mm each dNTPs (Invitrogen), 15 pmol of each primer for GHRH-R (E1/E8 in the primary PCR, E3/E4 in the nested PCR, Table 1) and 25 pmol of each primer for SVs (I 3-1/E12 in the pri- mary PCR, I 3-2/E8 in the nested PCR, Table 1) and GHRH (GHRH F/GHRH R, Table 1) and 2 U of DyNAzyme II DNA Polymerase (Finnzymes OY). Five per cent dimethylsulfoxide (DMSO) was used only for SVs. The final volume of the primary PCR was 50 ul for GHRH and 25 ul for both GHRH-R and its SVs, while the nested PCR was made in 25 ul for GHRH-R and in 50 ul for SVs. These reactions were performed in a GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA, USA) with the following cycle profiles: 5 min of denaturation at 95 ℃, 40 and 35 cycles of amplification, respectively, for the primary and the nested PCR (1 min at 95 ℃, 1 min at 62 ℃ for GHRH-R or 60 ℃ for SVs, 1 min at 72 ℃) and a final extension for 7 min at 72 ℃. The amplification of GHRH was performed with the following cycle profiles: 5 min at 95 ℃, 38 cycles of amplification (30 s at 95 ℃, 30 s at 60 ℃, 1 min at 72 ℃) and a final step of 7 min at 72 ℃.
The final PCR products were subjected to electrophoresis on 2% agarose gel, stained with 0-5 mg/l ethidium bromide and visualized under UV light.
Direct sequencing
The PCR products were purified by agarose gel electrophoresis and eluted using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). Cycle sequencing (96 °℃ for 10 s, 50 ℃ for 5 s, 60 ℃ for 4 min, for 25 cycles) was carried out on both strands of the purified products by a GeneAmp PCR System 9700 (Applied Biosystems) using the
| Gene | Primer* name | Location in | Direction | Sequence (5'-3') | |
|---|---|---|---|---|---|
| Gene | cDNA | ||||
| hGHRH-R | I3-1 | 56 183-56 204 | Sense | CCTACTGCCCTTAGGATGCTGG | |
| E12 | 63 890-63 911 | 1156-1177 | Antisense | GCAGTAGAGGATGGCAACAATG | |
| I3-2 | 56 262-56 283 | Sense | GCACCTTTGAAGCCAGAGAAGG | ||
| E8 | 61 039-61 060 | 806-827 | Antisense | CACGTGCCAGTGAAGAGCACGG | |
| E1 | 50 703-50 724 | 79-100 | Sense | TTCTGCGTGTTGAGCCCGTTAC | |
| E3 | 55 685-55 706 | 227-248 | Sense | ATGGGCTGCTGTGCTGGCCAAC | |
| E4 | 56 504-56 525 | 350-371 | Antisense | TAAGGTGGAAAGGGCTCAGACC | |
| hGHRH | GHRH F | 31-50 | 30-49 | Sense | ATTTGAGCAGTGCCTCGGAG |
| GHRH R | 392-411 | 331-350 | Antisense | TTTGTTCTGCCCACATGCTG | |
| hß-ACTIN | ß-actin F | 2 133-2162 | 541-570 | Sense | TGACGGGGTCACCCACACTGTGCCCATCTA |
| B-actin R | 2 971-3000 | 1172-1201 | Antisense | CTAGAAGCATTTGCGGTGGACGATGGAGGG | |
*The primers for GHRH-R were named according to the location of their sequences in the human GHRH-R gene (e.g. primer E8 is in exon 8, and I3 is in intron 3).
BigDye Terminator v1.1 Cycle Sequencing kit (Applied Biosystems) and 25 pmol of the forward or reverse primers, which were the same used in the PCR, in a final volume of 20 ul. The sequencing reactions were purified by DyeEx 2.0 Spin Columns (Qiagen) for dye-terminator removal, dried, resuspended in 20 ul of Template Suppression Reagent (Applied Biosystems), denatured at 95 ℃ for 5 min and subjected to automated capillary sequencing (ABI PRISM 310 Genetic Analyser, Applied Biosystems). Sequences were analysed on electropherograms with DNA Sequencing Analysis software for Macintosh (ABI PRISM EditView ABI Automated DNA Seequence Viewer 1-0-1, Applied Biosystems).
Results
Using primers annealing to intron 3, which is absent in the wild-type mRNA, and to exon 12 of the GHRH-R gene in the primary PCR, and primers designed for intron 3 and exon 8 in the nested PCR, we were able to amplify three fragments 720-, 566- and 335-bp long in some samples of adrenal carcinoma (Fig. 1). Sequence analyses of these three PCR fragments revealed open reading frames, which correspond to SV1, SV2 and SV4 of the GHRH-R. On the other hand, primers designed for exon 3, absent in all SVs, and exon 4 have allowed the amplification of the only wild-type receptor which was found to be expressed exclusively in pituitary tissue (data not shown).
The three SVs of the GHRH-R were present, in various proportions, in six of the 24 malignant tumours (25%) investigated, but absent in the adenomas, in normal adrenal tissue and in the NCI-H295R cells. In the six carcinomas positive for the SVs of GHRH-R, the more frequently found isoform was SV2 which was detected in five of 24 cancers (20-8%), whereas the incidence of SV1 and SV4 was 8.3% (two cancers) and 4-1% (one cancer), respectively. The simultaneous expression of SV1, SV2 and SV4 was observed in one carcinoma (patient 1, Table 2). Moreover, in patient 4 we found a heterozygous polymorphism of SV1 (C 276 to T in SV1 mRNA, codon 6 of SV1 coding region, gene bank accession number AF282259) without any aminoacid change (Table 2). The liver metastasis from a patient
M
1
2
3
4
1000 bp
720 bp
500 bp
566 bp
335 bp
200 bp
| Patient no. | SV1 | SV2 | SV4 | |
|---|---|---|---|---|
| 1 | + | + | + | |
| 2 | - | + | – | |
| 3 | - | + | – | |
| 4 | +* | – | – | |
| 5 | - | + | – | |
| 6 | - | + | – | |
| Positive/total examined | 6/24 | 2/24 | 5/24 | 1/24 |
| % Positive | 25% | 8.3% | 20-8% | 4.1% |
*C 276 T in codon 6.
| Patient no. | Age (years) | Sex | Outcome | Tumour size (cm) | Secretion |
|---|---|---|---|---|---|
| 1 | 69 | M | Metastasis | 13 | No |
| 2 | 15 | F | Metastasis/died | 12 | Cushing's |
| 3 | 46 | F | Cured | 9 | No |
| 4 | 43 | F | Metastasis/died | 20 | Cushing's |
| 5 | 58 | F | Cured | 10 | Cushing's |
| 6 | 26 | F | Metastasis/died | 8 | Cushing's |
whose primary adrenal carcinoma was negative, did not also show the expression of the receptors SVs. Finally, GHRH receptor variant SV3 was absent in all adrenal tissue samples or cell cultures.
By RT-PCR, all tumour samples investigated for the presence of GHRH-R and its SVs, were also analysed for their expression of GHRH mRNA. RT-PCR amplification resulted in a product of the expected size (322 bp confirmed by direct sequencing) in a sporadic phaeochromocytoma used as a positive control of GHRH gene expression. However, with different levels of intensity (data not shown), the same PCR product was observed in 11 of the 21 adenomas (52.4%) and 19 of the 24 carcinomas (79-2%) analysed in this study. Interestingly, all the carcinomas positive for the expression of SVs of the GHRH-R were also positive for the presence of GHRH mRNA. Finally, both normal adrenals were positive for GHRH mRNA.
Sex, age, type of secretion of the tumour, tumour size and outcome of the patients whose tumours expressed SVs of the GHRH-R did not differ significantly from those of the patients with carcinomas negative for SVs (Table 3). Furthermore, all carcinomas have been previously evaluated for IGF-II mRNA and found to overexpress this gene.33
Discussion
Expression of GHRH-R SVs has been described in several forms of experimental human cancer and cancer cell lines,7,9-11,13,14,23-28 as well as in primary human prostate cancer;32 however, at the present moment there are no studies regarding the expression of GHRH, GHRH-R and its SVs in human adrenal cancer cell lines or primary adrenal tumours. We have evaluated a large series of human adrenocortical tumours and the NCI-H295R human adrenocortical cancer cell line for the expression of these genes.
This study showed, for the first time, that some adrenal carcinomas do express SVs of GHRH-R while the expression is absent in adrenal adenomas and normal adrenal tissue. In addition, wild-type GHRH- R was not expressed either in normal or in pathological adrenal tissue. Six of 24 adrenal carcinomas (25%) showed the presence of mRNAs encoding SV1, SV2 and SV4 either alone or in combination, with the SV2 mRNA being the most frequently expressed form.
In human prostatic cancer the expression of SV2 was found to be as frequent as that of SV1. Moreover, in patients at high risk for recurrence, the incidence of SV1 expression was higher than that observed in the low-risk group, hinting at a possible role of GHRH and SVs of GHRH-R in the progression of the disease.32
Even though there are no currently available data about the activity of the other SVs, it may be surmised that the observed abnormal expression of GHRH-R SVs may exert in some adrenal carcinomas an oncogenic action possibly acting in an autocrine/paracrine manner through IGF-II which is overexpressed in adrenal neoplasms.33 Surprisingly, the carcinoma NCI-H295R cells do not express any splice variants confirming that GHRH-R SVs expression could be only one of the mechanisms in adrenal carcinogenesis.
Our results of GHRH gene expression support this hypothesis, although the expression of GHRH in adrenal tissue cannot be con- sidered a marker of malignancy. Indeed, mRNA was found not only in malignant tumours (19 of 24 examined samples were positive) but also in benign tumours (11 of 21 were positive) as well as in the normal adrenal gland. Recent data suggest that adrenocortical cells under pathological as well as physiological conditions show neuroendocrine differentiation. In addition, adrenal carcinomas may show signs of neuroendocrine differentiation and share some features with phaeochromocytoma.35-37 Moreover, GHRH could function as an autocrine growth factor in many malignant tumours (breast, prostate, lung, etc.).12
The IGF-II overexpression, local production of GHRH and the presence of its tumoural receptors (SVs) in the adrenal carcinomas support the existence of an autocrine mitogenic loop in the pathogenesis of adrenocortical neoplasia.
The availability of potent GHRH antagonists might open a new therapeutic approach for some forms of human adrenal carcinoma. Indeed, these antagonists may exert their effects by blocking the action of GHRH-R SVs resulting in a decrease of tumoural IGF-II level, a protein frequently overexpressed in adrenal carcinomas. Another mechanism of SVs antioncogenic effects may be through inhibition of telomerase activity,38 which has been found to be increased in adrenocortical carcinomas.39
We were not able to correlate the expression of SVs with any clinical or pathological features in our cases and as a consequence we cannot speculate on the potential clinical significance of our results. However, a longer period of observation may be necessary for such a correlation to become demonstrable.
Acknowledgements
Simona Freddi is supported by a Fellowship from Fondazione Italiana per la Ricerca sul Cancro (FIRC). We also thank the ENSAT for providing us some tumoural samples.
References
1 Koch, C.A., Pacak, K. & Chrousos, G.P. (2002) Genetic of Endocrine Disease The molecular pathogenesis of hereditary and sporadic adrenocortical and adrenomedullary tumors. Journal of Clinical Endocrinology and Metabolism, 87, 5367-5384.
2 Zarandi, M., Kovacs, M., Horvath, J.E., Toth, K., Halmos, G., Groot, K., Nagy, A., Kele, Z. & Schally, A.V. (1997) Synthesis and in vitro evaluation of new potent antagonists of growth hormone-releasing hormone (GH-RH). Peptides, 18, 423-430.
3 Varga, J.L., Schally, A.V., Csernus, V.J., Zarandi, M., Halmos, G., Groot, K. & Rekasi, Z. (1999) Synthesis and biological evaluation of antagonists of growth hormone-releasing hormone with high and
protracted in vivo activities. Proceedings of the National Academy of Sciences of the USA, 96, 692-697.
4 Varga, J.L., Schally, A.V., Horvath, J.E., Kovacs, M., Halmos, G., Groot, K., Toller, G.L., Rekasi, Z. & Zarandi, M. (2004) Increased activity of antagonists of growth hormone-releasing hormone substituted at positions 8, 9, and 10. Proceedings of the National Academy of Sciences of the USA, 101, 1708-1713.
5 Lamharzi, N., Schally, A.V., Koppan, M. & Groot, K. (1998) Growth hormone-releasing hormone antagonist MZ-5-156 inhibits growth of DU-145 human androgen-independent prostate carcinoma in nude mice and suppresses the levels and mRNA expression of insulin-like growth factor II in tumors. Proceedings of the National Academy of Sciences of the USA, 95, 8864-8868.
6 Rekasi, Z., Varga, J.L., Schally, A.V., Halmos, G., Armatis, P., Groot, K. & Czompoly, T. (2000) Antagonists of growth hormone-releasing hormone and vasoactive intestinal peptide inhibit tumor proliferation by different mechanisms: evidence from in vitro studies on human prostatic and pancreatic cancers. Endocrinology, 141, 2120-2128.
7 Letsch, M., Schally, A.V., Busto, R., Bajo, A.M. & Varga, J.L. (2003) Growth hormone-releasing hormone (GHRH) antagonists inhibit the proliferation of androgen-dependent and -independent prostate cancers. Proceedings of the National Academy of Sciences of the USA, 100, 1250-1255.
8 Letsch, M., Schally, A.V., Stangelberger, A., Groot, K. & Varga, J.L. (2004) Antagonists of growth hormone-releasing hormone (GH-RH) enhance tumor growth inhibition induced by androgen deprivation in human MDA-Pca-2b prostate cancers. European Journal of Cancer, 40, 436-444.
9 Chatzistamou, I., Schally, A.V., Varga, J.L., Groot, K., Busto, R., Armatis, P. & Halmos, G. (2001) Inhibition of growth and metastases of MDA-MB-435 human estrogen-independent breast cancers by an antagonist of growth hormone-releasing hormone. Anticancer Drugs, 12, 761-768.
10 Chatzistamou, I., Schally, A.V., Varga, J.L., Groot, K., Armatis, P., Busto, R. & Halmos, G. (2001) Antagonists of growth hormone- releasing hormone and somatostatin analog RC-160 inhibit the growth of OV-1063 human epithelial ovarian cancer cell line xenografted into nude mice. Journal of Clinical Endocrinology and Metabolism, 86, 2144-2152.
11 Halmos, G., Schally, A.V., Varga, J.L., Plonowski, A., Rekasi, Z. & Czompoly, T. (2000) Human renal cell carcinoma expresses distinct binding sites for growth hormone-releasing hormone. Proceedings of the National Academy of Sciences of the USA, 97, 10555-10560.
12 Kiaris, H., Schally, A.V., Varga, J.L., Groot, K. & Armatis, P. (1999) Growth hormone-releasing hormone: an autocrine growth factor for small cell lung carcinoma. Proceedings of the National Academy of Sciences of the USA, 96, 14894-14898.
13 Szereday, Z., Schally, A.V., Varga, J.L. et al. (2003) Antagonists of growth hormone-releasing hormone inhibit the proliferation of experi- mental non-small cell lung carcinoma. Cancer Research, 63, 7913- 7919.
14 Kanashiro, C.A., Schally, A.V., Groot, K., Armatis, P., Bernardino, A.L.F. & Varga, J.L. (2003) Inhibition of mutant p53 expression and growth of DMS-153 small cell lung carcinoma by antagonists of growth hormone-releasing hormone and bombesin. Proceedings of the National Academy of Sciences of the USA, 100, 15836-15841.
15 Szepeshazi, K., Schally, A.V., Groot, K., Armatis, P., Hebert, F. & Halmos, G. (2000) Antagonists of growth hormone-releasing hormone (GH-RH) inhibit in vivo proliferation of experimental pancreatic cancers and decrease IGF-II levels in tumors. European Journal of Cancer, 36, 128-136.
16 Szepeshazi, K., Schally, A.V., Groot, K., Armatis, P., Halmos, G., Hebert, F., Szende, B., Varga, J.L. & Zarandi, M. (2000) Antagonists of growth hormone-releasing hormone (GH-RH) inhibit IGF-II production and growth of HT-29 human colon cancers. British Journal of Cancer, 82, 1724-1731.
17 Braczkowski, R., Schally, A.V., Plonowski, A., Varga, J.L., Groot, K., Krupa, M. & Armatis, P. (2002) Inhibition of proliferation in human MNNG/HOS osteosarcoma and SK-ES-1 Ewing sarcoma cell lines in vitro and in vivo by antagonists of growth hormone-releasing hormone: effects on insulin-like growth factor II. Cancer, 95, 1735-1745.
18 Kiaris, H., Schally, A.V. & Varga, J.L. (2000) Antagonists of growth hormone-releasing hormone inhibit the growth of U-87MG human glioblastoma in nude mice. Neoplasia, 2, 242-250.
19 Schally, A.V. & Varga, J.L. (1999) Antagonistic analogs of growth hormone-releasing hormone (GH-RH): new potential antitumor agents. Trends in Endocrinology and Metabolism, 10, 383-391.
20 Rekasi, Z., Czompoly, T., Schally, A.V. & Halmos, G. (2000b) Isolation and sequencing of cDNA for splice variants of growth hormone- releasing hormone receptors from human cancers. Proceedings of the National Academy of Sciences of the USA, 97, 10561-10566.
21 Schally, A.V., Comaru-Schally, A.M., Nagy, A., Kovacs, M., Szepeshazi, K., Plonowski, A., Varga, J.L. & Halmos, G. (2001) Hypothalamic hormones and cancer. Frontiers in Neuroendocrinology, 22, 248-291.
22 Kineman, R.D. (2000) Antitumorigenic actions of growth hormone- releasing hormone antagonists. Proceedings of the National Academy of Sciences of the USA, 97, 532-534.
23 Csernus, V.J., Schally, A.V., Kiaris, H. & Armatis, P. (1999) Inhibition of growth, production of insulin-like growth factor-II (IGF-II) and expression of IGF-II mRNA of human cancer cell-lines by antagonistic analogs of growth hormone-releasing hormone in vitro. Proceedings of the National Academy of Sciences of the USA, 96, 3098-3103.
24 Busto, R., Schally, A.V., Braczkowski, R., Plonowski, A., Krupa, M., Groot, K., Armatis, P. & Varga, J.L. (2002) Expression of mRNA for growth hormone-releasing hormone and splice variants of GHRH receptors in human malignant bone tumors. Regulatory Peptides, 108, 47-53.
25 Chopin, L.K. & Herington, A.C. (2001) A potential autocrine pathway for growth hormone releasing hormone (GH-RH) and its receptor in human prostate cancer cell lines. Prostate, 49, 116-121.
26 Plonowski, A., Schally, A.V., Busto, R., Krupa, M., Varga, J.L. & Halmos, G. (2002) Expression of growth hormone-releasing hormone (GH-RH) and splice variants of GH-RH receptors in human experi- mental prostate cancers. Peptides, 23, 1127-1133.
27 Busto, R., Schally, A.V., Varga, J.L., Garcia-Fernandez, M.O., Groot, K., Armatis, P. & Szepeshazi, K. (2002) The expression of growth hormone-releasing hormone (GH-RH) and splice variants of its receptor in human gastroenteropancreatic carcinomas. Proceedings of the National Academy of Sciences of the USA, 99, 11866-11871.
28 Garcia Fernandez, M.O., Schally, A.V., Varga, J.L., Groot, K. & Busto, R. (2003) The expression of growth hormone-releasing hormone (GH-RH) and its receptor splice variants in human breast cancer cell lines: the evaluation of signalling mechanisms in the stimulation of cell proliferation. Breast Cancer Research and Treatment, 77, 15-26.
29 Kiaris, H., Chatzistamou, I., Schally, A.V., Halmos, G., Varga, J.L., Koutselini, H. & Kalofoutis, A. (2003) Ligand-dependent and -independent effects of splice variant 1 of growth hormone-releasing hormone receptor. Proceedings of the National Academy of Sciences of the USA, 100, 9512-9517.
30 Kiaris, H., Schally, A.V., Busto, R., Halmos, G., Artavanis-Tsakonas, S. & Varga, J.L. (2002) Expression of a splice variant of the receptor
for GH-RH in 3T3 fibroblasts activates cell proliferation responses to GH-RH analogs. Proceedings of the National Academy of Sciences of the USA, 99, 196-200.
31 Kahan, Z., Arencibia, J., Csernus, V., Groot, K., Kineman, R., Robinson, W.R. & Schally, A.V. (1999) Expression of growth hormone- releasing hormone (GH-RH) messenger ribonucleic acid and the presence of biologically active GH-RH in human breast, endometrial, and ovarian cancers. Journal of Clinical Endocrinology and Metabolism, 84, 582-589.
32 Halmos, G., Schally, A.V., Czompoly, T., Krupa, M., Varga, J.L. & Rekasi, Z. (2002) Expression of growth hormone-releasing hormone and its receptor splice variants in human prostate cancer. Journal of Clinical Endocrinology and Metabolism, 87, 4707-4714.
33 Gicquel, C., Bertagna, X., Gaston, V. et al. (2001) Molecular markers and long-term recurrences in a large cohort of patients with sporadic adrenocortical tumors. Cancer Research, 61, 6762-6767.
34 Nakajima-Iijima, S., Hamada, H., Reddy, P. & Kakunaga, T. (1985) Molecular structure of the human cytoplasmic ß-actin gene:
interspecies homology of sequences in the introns. Proceedings of the National Academy of Sciences of the USA, 82, 6133-6137.
35 Ehrhart-Bornstein, M. & Hilbers, U. (1998) Neuroendocrine properties of adrenocortical cells. Hormone and Metabolic Research, 30, 436-439.
36 Haak, H.R. & Fleuren, G.J. (1995) Neuroendocrine differentiation of adrenocortical tumors. Cancer, 75, 860-864.
37 Miettinen, M. (1992) Neuroendocrine differentiation in adrenocortical carcinoma. New immunohistochemical findings supported by electron microscopy. Laboratory Investigation, 66, 169-174.
38 Kiaris, H. & Schally, A.V. (1999) Decrease in telomerase activity in U-87MG human glioblastomas after treatment with an antagonist of growth hormone-releasing hormone. Proceedings of the National Academy of Sciences of the USA, 96, 226-231.
39 Mannelli, M., Gelmini, S., Arnaldi, G. et al. (2000) Telomerase activ- ity is significantly enhanced in malignant adrenocortical tumors in comparision to benign adrenocortical adenomas. Journal of Clinical Endocrinology and Metabolism, 85, 468-470.