ORIGINAL ARTICLE
Expression of activin and inhibin subunits, receptors and binding proteins in human adrenocortical neoplasms
J. Hofland*, M. A. Timmerman*, W. W. de Herder*, R. H. N. van Schaik*, R. R. de Krijgert and F. H. de Jong*
*Department of Internal Medicine, Section of Endocrinology, and tDepartment of Pathology, Erasmus MC, Rotterdam, the Netherlands
Summary
Objective The growth and differentiation factors activin and inhibin can affect tumour formation and steroid production in the adrenal cortex. These factors bind to type I (Alk-4), type II (ActRIIA, ActRIIB) and type III (betaglycan) receptors or to the activin-binding protein follistatin. Expression of these activin-related mRNAs was measured in different types of adrenocortical tissues and tumours to study the relationship with tumorigenesis.
Design Quantitative expression of activin-related mRNAs was investigated in patient adrenocortical samples.
Patients Twenty-eight human adrenocortical samples from normal and hyperplastic adrenals and from adrenocortical adenomas and carcinomas were collected after surgery for study purposes.
Measurements Using quantitative reverse transcription polymerase chain reaction (RT-PCR), we investigated the expression of inhibin a-, BA- and BB-subunits, follistatin, betaglycan, ActRIIA, ActRIIB and Alk-4 in the adrenocortical tissues. The expression of cyto- chrome P450c17 (CYP17) mRNA was also measured to investigate its association with inhibin and activin subunit expression.
Results All genes studied were expressed in all tissues, with the exception of the inhibin o-subunit in one hyperplastic adrenal and three adrenocortical carcinomas. Expression of inhibin BA-subunit, follistatin, betaglycan, ActRIIA, ActRIIB and CYP17 differed between nontumorous adrenals and carcinomas.
Conclusions These differences, together with correlation analysis, indicate parallel regulation of the expression of CYP17, the inhibin a-subunit, ActRIIA, ActRIIB, betaglycan and follistatin. We con- clude that the expression of activin and inhibin subunits, receptors and binding proteins is affected by tumour formation in the adrenal gland and may play a role in tumorigenesis.
(Received 14 May 2006; returned for revision 12 June 2006; finally revised 6 July 2006; accepted 7 July 2006)
Correspondence: F. H. de Jong, Endocrine Laboratory, Room Ee 516, Department of Internal Medicine, Erasmus MC, PO Box 2040, 3000 CA Rotterdam, the Netherlands. Tel .: + 31 10 4087575; Fax: + 31 10 4635430; E-mail: f.h.dejong@erasmusmc.nl
Introduction
Adrenal tumours are common among the general population, with a prevalence of 0-35-4-36% of so-called incidentalomas in patients undergoing a computed tomography (CT) scan for reasons other than adrenal mass suspicion.” Autopsy studies suggest a prevalence of incidentalomas of about 2-1%.2 Most of these tumours are non- secretory adrenal adenomas (74-0%), but a minority consists of hypersecretory adenomas (14-8%) or carcinomas (4-0%).3 Patients with functional adenomas of the adrenal cortex can present with Cushing’s syndrome, Conn’s syndrome, virilization, or combined hormone excess syndromes. Adrenocortical carcinomas are hyper- secretory in approximately 50% of the cases.4 Familial adrenocortical tumorigenesis has been linked with Li-Fraumeni syndrome (LFS; OMIM 151623), Beckwith-Wiedemann syndrome (OMIM 130650) and Carney complex type I (CNC1; OMIM 160980), with several gene mutations (e.g. in G-protein-coupled receptors and p53) and with overexpression of certain adrenocortical-specific factors (e.g. steroid acute regulatory protein).4,5
Tumour formation in the adrenal cortex has also been linked with the glycoproteins inhibin and activin since Matzuk et al.6 showed that inhibin «-subunit knockout mice developed adrenocortical tumours with 99% penetrance after gonadectomy, which prevented early death of the animals due to ovarian or testicular tumours. Inhibins were first discovered to regulate FSH release from the pitu- itary gland.7 The molecules antagonize the action of their counter- parts, the activins. Like other members of the transforming growth factor-beta (TGF-B) superfamily of growth and differentiation factors, activins and inhibins are dimeric glycoproteins.8 Whereas inhibin is composed of an «- and a ß-subunit, activin is made up of two ß-subunits. One o-subunit and two different ß-subunits (BA and ßB) make up inhibin A (aßA), inhibin B (aßB), activin A (BABA), activin B (BBBB) or activin AB (BAßB). Activin binds to type II (ActRIIA and ActRIIB) and type I (Alk-4) receptors. This assembly transfers a signal into the cell, where receptor-specific, common-mediator and inhibitory Smads relay the signal and influence gene expression.” Inhibin can bind to the type III receptor betaglycan and subsequently also to ActRIIA or ActRIIB,10 blocking activin sig- nalling.” The activin-binding protein follistatin also inhibits the actions of activin.12 Activin and inhibin have been studied extensively in the ovary and testis, where both may influence follicle development and spermatogenesis. Throughout the human body activins exert
many functions in tumorigenesis, wound healing, erythropoiesis, tissue differentiation, mesoderm induction and bone growth.8,15 Extrapituitary functions of inhibins are still largely unclear.1
Expression and production of inhibin and activin, their subunits, receptors, binding and signalling proteins have been described in the adrenal cortex.14-20 The proteins are mostly present in the zonae fasciculata and reticularis, the glucocorticoid and androgen secret- ing sections of the adrenal cortex.15,16,19,21 It has been shown that the production of activin and inhibin is regulated by ACTH and 8-BrcAMP18 and that activin can suppress adrenocortical steroido- genesis.19,22,23 The tumour suppressor role of inhibin in gonadectomized inhibin a-subunit knockout mice6 has not always been supported by studies in human adrenocortical adenomas and carcinomas.15,16,21,24,25
The aim of this study was to investigate the presence of the activin- signalling pathway in the normal adrenal cortex and in adreno- cortical tumours in detail. We quantified the expression of inhibin and activin subunits, their receptors and binding proteins and of the steroidogenic enzyme cytochrome P450c17 (CYP17) in normal, hyperplastic and tumorous adrenocortical tissues. We performed real-time reverse transcription polymerase chain reaction (RT-PCR) in several groups of adrenal neoplasms to gain an insight into the differential expression of these genes and to obtain an indication of a possible role of these proteins in tumour formation and steroidogenesis in the adrenal cortex.
Materials and methods
Patient material
Samples of normal adrenal tissues and adrenocortical neoplasms were obtained from patients undergoing abdominal surgery at the Erasmus MC, Rotterdam, from 1991 to 2004. Normal adrenal tissues were collected after nephrectomy or pheochromocytoma surgery. These tissues were used under the guidelines that had been approved by the medical ethics committee of the Erasmus MC. After extirpation, samples were immediately frozen in liquid nitrogen and stored at -80 ℃ by the Erasmus MC Tissue Bank until the extraction of RNA. Malignancy of the adrenocortical tumour was assumed whenever metastases were present or a van Slooten index greater than 8 was found.26
RNA isolation
RNA was isolated from one term placenta, the endometrium tumour cell line ECC-1 (courtesy of Dr J. Foekens), five normal adrenal glands, five hyperplastic adrenals resulting from pituitary ACTH- secreting adenomas, four adrenocortical adenomas and 14 adreno- cortical carcinomas. Total RNA was extracted from frozen (-80 ℃) samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol with some modifications. The phase separation was performed at 13 000 g for 10 min at room temperature, the precipitation at 14 000 g for 10 min at 4 ℃ and the wash step at 14 000 g for 5 min at 4 ℃. The RNA pellet was dissolved in 25 ul sterile water. Incubation at 55-60 ℃ was omitted. Samples were frozen overnight at -20 ℃. RNA was measured by spectro- photometry and OD 260/280 ratios > 1-6 were obtained for all samples.
Quantitative RT-PCR
For the reverse transcription reaction 1.0 µg of sample RNA was mixed with 1.25 ul (25 UM) 10 x concentrated hexanucleotide mix (Roche Applied Science, Penzberg, Germany) and 1-25 ul (200 nM) oligo(dT)15 (Promega Benelux B.V., Leiden, the Netherlands) in an Eppendorf tube in duplicate. To obtain samples for standard curves, reactions were performed with 1-0, 0-3, 0-1, 0-03 and 0.01 µg RNA of placenta, ECC-1 (inhibin ßB-subunit) and a hyperplastic adren- ocortical sample (CYP17). The volume was made up to 15-0 ul with sterile water. Subsequently, the mix was placed in a heat block for 5 min at 70 ℃ and then directly placed on ice to unfold all secondary loops in the RNA. Then a 10-ul mix was added containing 0.5 ul (10 mm) dNTPs (Amersham Biosciences, UK), 5-0 ul 5 × RT-buffer (Promega), 0-625 ul (40 U/ml) rRNasin (Promega), 1-0 ul (200 U/ml) Moloney Murine Leukaemia Virus (M-MLV, Promega) and 2.88 ul sterile water. To check for the presence of genomic DNA an RT- minus reaction for each sample was made by replacing the M- MLV with 1.0 ul sterile water. The RT reaction was realized by placing the reaction mix successively in a water bath at 37 ℃ for 45 min, in a water bath at 42 ℃ for 15 min and in a heat block at 94 ℃ for 5 min. The tubes were put on ice immediately and 100 ul of sterile water was added to the synthesized cDNA.
Primers and probes for the PCR reaction (Table 1) were designed using Primer Express software (PE Biosystems, Foster City, CA, USA). Most primers were obtained from Invitrogen, the glyceralde- hydephosphate dehydrogenase (GAPDH) and CYP17 primers and most HPLC-purified probes from Eurogentec (Liege, Belgium). The primers and the HPLC-purified probe for hypoxanthine ribosyl transferase (HPRT) were purchased from Biosource (Nivelles, Belgium). Quantitative PCR reactions were performed in a 25 ul volume, consisting of 12-5 ul Taqman® Universal PCR Master Mix (Roche), 7-5 pmol forward primer, 7-5 pmol reverse primer, 5-0 pmol probe, 5-0 ul cDNA sample and sterile water. The reactions were performed in an ABI Prism 7700 Sequence Detector (Applied Biosystems, Nieuwerkerk aan den IJssel, the Netherlands) as follows: 2 min at 50 ℃, 10 min at 95 ℃ and 40 cycles of 15 s at 95 ℃ and 1 min at 60 ℃. Analysis of PCR results was carried out with ABI 7700 Prism software (Applied Biosystems). Threshold cycle (Ct) was calculated as the cycle at which the emitted photon energy of the reporter passed the background energy plus 10 times its standard deviation. Parallelism of the curve for standard and adrenal tissue was proven beforehand. RNA levels were calculated relative to expression of a housekeeping gene, GAPDH or HPRT, according to the following formula:
Arbitrary units = 2-(Ct gene - Ct housekeeping gene)
Statistical analysis
Data analysis of quantitative RT-PCR experiments was performed first using Kruskall-Wallis tests. Differences between individual groups were subsequently analysed by Mann-Whitney U-tests. Cor- relations between gene expressions were performed with Spearman’s test. SPSS 11.0 for Windows was used for analysis. All tests were calculated as two-tailed. Statistical significance was assumed at
| Gene | Amplicon size (bp) | Primers 5'-3' | Probe 5' FAM-3' TAMRA |
|---|---|---|---|
| a-subunit | 258 | CCGAGGAAGAGGAGGATGTCT CGGTGACAGTGCCAGCAG | TGACTTCAGCCCAGCTGTGGTTCCA |
| BA-subunit | 165 | CCTCGGAGATCATCACGTTTG GGCGGATGGTGACTTTGGT | CTGACAGGTCACTGCCTTCCTTGGAAATCT |
| BB-subunit | 215 | ACGGCCGCGTGGAGAT GGACGTAGGGCAGGAGTTTCA | TCCGAAATCATCAGCTTCGCCGA |
| Betaglycan | 189 | ACCCCCAACTCTAACCCCTACA GCCAATACTGTTAGGACAATAATTTTC | TCCTGATCTTGAAGTGCAAAAAGTCTGTCAACTG |
| Follistatin | 105 | GAGGAGGACGTGAATGACAACA TCCACAGTCCACGTTCTCACA | CCCCCGTTGAAAATCATCCACTTGAAGAG |
| Alk-4 | 220 | CATCATTGTTTTCCTTGTCATTAACTATC CTTGCCAATAATCTCTTGTAAAACGA | AGCGCACAGTGGCCCGAACC |
| ActRIIA | 98 | TTCTCGCTGTACTGCTGCAGAT CTTCCTGCATGTCTTCAAGAGATG | TGGCCAATTTCCTCCTCAAATGGCA |
| ActRIIB | 160 | TCAGCACACCTGGCATGAAG AGTTCGTTCCATGTGATGATGTTC | ACAAGGGCTCCCTCACGGATTACCTCA |
| HPRT45 | 109 | TGCTTTCCTTGGTCAGGCAGTAT TCAAATCCAACAAAGTCTGGCTTATATC | CAAGCTTGCGACCTTGACCATCTTTGGA |
| GAPDH | 70 | ATGGGGAAGGTGAAGGTCG TAAAAGCAGCCCTGGTGACC | CGCCCAATACGACCAAATCCGTTGAC |
| CYP1746 | 63 | TCTCTGGGCGGCCTCAA AGGCGATACCCTTACGGTTGT | TGGCAACTCTAGACATCGCGTCC |
P < 0.05. The Bonferroni-Holm correction was applied to the correlation analyses to allow for multiple testing.
Results
Samples were divided into groups based on the type of autonomous tumour formation. Non-neoplastic tissues consisted of normal and hyperplastic adrenal cortex samples. Benign and malignant neoplas- tic tissues constituted two groups of adrenocortical adenomas and carcinomas, respectively. Patient characteristics of all samples are summarized in Table 2.
Slopes of the standard curves in the real-time RT-PCR experi- ments were between -3-0 and -3-7, correlation coefficients were above 0.92 and the Y-intercepts at 1.0 ng RNA were below Ct 36. Each sample yielded a Ct value for all of the genes studied (Ct ≤ 36), except for the inhibin a-subunit in one hyperplastic adrenal and three carcinomas. Expression of the housekeeping genes GAPDH and HPRT showed a significant correlation in the 28 samples (r = 0-652; P < 0-001). We chose to normalize all values of measured expression in our samples relative to expression of the most commonly used housekeeping gene, GAPDH.
All genes studied by RT-PCR were expressed in all groups of tissues. Results are shown in Table 3. Overall analyses by Kruskall-Wallis tests showed significant differences between nontumorous, adeno- matous and carcinomatous adrenals for follistatin (P=0-030), betaglycan (P=0-011), ActRIIA (P=0-036), ActRIIB (P= 0-012) and CYP17 (P=0-001). Expression of the inhibin BA-subunit showed a trend towards differences between the groups of tissues (P = 0-094). These differences in mRNA expressions of inhibin
BA-subunit (P=0-048), follistatin (P=0-011), betaglycan (P= 0-003), ActRIIA (P=0-026), ActRIIB (P=0-003) and CYP17 (P <0-001) were all based on the decreased expression in the adren- ocortical carcinomas compared to the normal and hyperplastic adrenals (Mann-Whitney U-tests). No differences were detected for the other genes studied or between the adenomas and any of the other two groups.
We found several significant correlations between the levels of individually coupled gene expression in the 28 adrenocortical sam- ples. These are depicted in Table 4. Relevant correlations between expressions of CYP17 and other genes are shown in Fig. 1.
Discussion
Since the first detection of activin and inhibin in the human adrenal gland,20 it has been found that these proteins can exert effects upon adrenal function. Several studies have uncovered correlations between activin expression and adrenocortical steroidogenesis.14,18-20,23 Other reports illustrated the relationship between activin and inhibin and adrenal neoplasms.6,16,21,24,25,27-30 In the present study, we measured the expression of mRNA encoding activin and inhibin subunits in neoplasms of the human adult adrenal cortex together with the expression of their receptors and binding proteins by quantitative RT-PCR to investigate possible functional differences and their interrelationships.
Expression of the inhibin- and activin-related genes and CYP17 was normalized on the basis of GAPDH because its variance is smaller than that of HPRT.31 The results of our experiments on the expression of activin and inhibin subunits are in accordance with
| Normal and hyperplastic adrenals | Adrenocortical adenoma | Adrenocortical carcinoma | |
|---|---|---|---|
| Number of samples | 10 | 4 | 14 |
| Sex | |||
| Female | 6 | 3 | 9 |
| Male | 4 | 1 | 5 |
| Age at operation, years (mean ± SEM) | 50-1 ± 5.2 | 42-0 ± 4.8 | 53.1 ± 2.4 |
| Maximal tumour diameter, cm (mean ± SEM) | – | 6.4 ± 1.8 | 10±1.7 |
| Left adrenal | 4 | 2 | 6 |
| Right adrenal | 3 | 2 | 8 |
| Bilateral | 3 | – | – |
| Normal and hyperplastic adrenal cortex (n = 10) | Adrenocortical adenoma (n = 4) | Adrenocortical carcinoma (n = 14) | |
|---|---|---|---|
| a-subunit | 0·19±0·085 | 0·19±0·12 | 0-094±0·035 |
| BA-subunit | 0·16±0-0132 | 0·17 ± 0-030 | 0-13 ± 0-044ª |
| ßB-subunit | 0·089 ± 0-036 | 0-018 ± 0.012 | 0·034± 0-0059 |
| Follistatin | 0.13 ± 0-030b | 0·24 ±0.18 | 0-046 ± 0-013b |
| Betaglycan | 0-48 ± 0.16° | 0·26 ±0.11 | 0-098 ± 0-027℃ |
| Alk-4 | 0-034±0-014 | 0-013 ± 0.0054 | 0·013 ±0-0034 |
| ActRIIA | 0.34 ± 0-077ª | 0·31 ±0.11 | 0.13 ± 0-025ª |
| ActRIIB | 1.1 ± 0.21e | 1.0 ± 0-42 | 0·43 ± 0-069€ |
| CYP17 | 4783 ± 769 | 6475 ± 4533 | 492 ± 188f |
| Inhibin a-subunit | Inhibin BA-subunit | Inhibin BB-subunit | Follistatin | Betaglycan | Alk-4 | ActRIIA | ActRIIB | CYP17 | |
|---|---|---|---|---|---|---|---|---|---|
| Inhibin a-subunit | – | 0-129 | 0-160 | 0-352 | 0.724 | 0-532 | 0-508 | 0-244 | 0-663 |
| Inhibin BA-subunit | 0.515 | – | 0-265 | 0-372 | 0-299 | 0-109 | 0-370 | 0-383 | 0-198 |
| Inhibin BB-subunit | 0-415 | 0.173 | – | 0-010 | 0-264 | 0-430 | 0-063 | 0-020 | 0-187 |
| Follistatin | 0-067 | 0-051 | 0-958 | – | 0-673 | 0-264 | 0-663 | 0-762 | 0-610 |
| Betaglycan | <0-001 | 0-122 | 0.175 | < 0-001 | – | 0-719 | 0-718 | 0-604 | 0-802 |
| Alk-4 | 0-004 | 0-579 | 0-022 | 0-174 | < 0-001 | – | 0-473 | 0-419 | 0-545 |
| ActRIIA | 0-006 | 0-053 | 0.751 | <0-001 | <0-001 | 0-011 | – | 0-695 | 0-563 |
| ActRIIB | 0-210 | 0-044 | 0-920 | < 0.001 | 0-001 | 0-027 | < 0-001 | – | 0-634 |
| CYP17 | < 0-001 | 0.314 | 0-340 | 0-001 | <0-001 | 0-003 | 0-002 | < 0.001 | – |
other reports showing predominantly nonquantitative evidence for the presence of mRNA of these proteins in the adrenal cortex, both in vitro and in vivo. 18-20,23,27,32
Of the various mRNAs we measured in the adrenal cortex, the a-subunit of inhibin has been most extensively studied. Using inhibin «-subunit knockout mice, Matzuk et al.6 showed the poten- tial of the a-subunit as a tumour suppressor with primarily gonadal specificity and secondary adrenocortical effects after gonadectomy. This association could not be confirmed in human adrenocortical benign and malignant neoplasms. Instead, «-subunit expression
seems to be upregulated in certain adrenocortical adenomas or carcinomas, but this is not consistent between studies. 16,21,24,25,33 Our study showed no differences in inhibin «-subunit expression between the groups of nontumorous adrenals, adenomas and carci- nomas. Only two other studies21,25 have investigated mRNA expression of the a-subunit in a semiquantitative manner in adrenocortical tumours; as in our study, these authors did not find any differences between the different types of tumours.
However, we found several samples in which no inhibin o-subunit expression could be detected. Detection of mRNAs of the other genes
1
1
0.1
Inhibin o-subunit
0.1
Follistatin
0-01
0-01
0-001
0.0001
0-001
0-00001
0-0001
0-001
0-01
0.1
1
10
100
0-00001
0.0001
0-001
0-01
0.1
1
10
100
CYP17
CYP17
10
1
1
8
Betaglycan
d
ActRIIA
0-1
0-1
0-01
0-001
0-01
0-00001
0.0001
0-001
0-01
0.1
1
10
100
0-00001
0-0001
0.001
0-01
0.1
1
10
100
CYP17
CYP17
10
1
%
ActRIIB
=
8
0-1
0-01
0-00001
0.0001
0-001
0-01
0-1
1
10
100
CYP17
in these samples indicates that this loss of expression of a-subunit is not due to breakdown of mRNA. Pelkey et al.33 and Munro et al.16 have previously reported loss of a-subunit protein in adrenocortical adenomas and carcinomas. We found loss of inhibin o-subunit expression in three adrenocortical carcinomas and one hyperplastic adrenal. Thus, a subgroup of the adrenocortical neoplasms could have developed as a consequence of loss of inhibin o-subunit, as was described by Matzuk et al.
Differences in inhibin BA- and ßB-subunits in adrenal neoplasms have not been studied in great detail. Munro et al.16 did not find any
significant changes in BA- and ßB-subunits between the normal adrenal cortex and tumours after performing immunohistochemis- try. In contrast to that study, our current study detected a decrease in inhibin BA-subunit mRNA expression in carcinomas compared to nontumorous adrenals. These results, however, must be inter- preted cautiously because of the small difference in expression and the absence of a significant difference in overall analysis. In the adrenocortical carcinoma cell line H295R, treatment with activin A led to an increased rate of apoptosis.” Possibly, the anti-apoptotic role of activin A is lost, which could have added to the process of
tumorigenesis in the carcinoma samples. The inhibin BB-subunit does not seem to play any discriminative role between the types of adrenocortical tissues due to the absence of a difference in expression.
Qualitative adrenal expression of ActRIIA, ActRIIB, Alk-4, betaglycan and follistatin mRNAs was shown previously by Väntinnen et al.18 and Suzuki et al.23 in normal human foetal and adult adrenals and the H295R cell line. However, we are the first to study the expression levels of these mRNAs in different types of adrenocortical neoplasms.
In our study carcinomas were found to have decreased levels of expression of CYP17, follistatin, betaglycan, ActRIIA and ActRIIB compared to normal and hyperplastic adrenals. Correlation analysis of our real-time RT-PCR data revealed significant relationships between the levels of expression of CYP17, on the one hand, and follistatin, betaglycan and the activin type II receptors on the other. Inhibin o-subunit expression also had significant correlation with CYP17 and betaglycan expression. The expression patterns in the groups of tissues combined with the correlations between mRNA levels suggest that expression of these genes is regulated in parallel. ACTH controls the cAMP concentration in the adrenocortical cell and thereby regulates expression of CYP17 through cAMP-responsive sequences.34 The regulation of expression of the inhibin o-subunit, follistatin and, more recently, betaglycan, ActRIIA and ActRIIB mRNAs have been investigated in gonadal cells,35-38 where PKA stimulation also increases the expression of these five proteins. By contrast, Aloi et al.39 detected inhibition of ovarian ActRIIA expression after administration of gonadotrophins in hypophysectomized rats.
The activity of the ACTH/cAMP/PKA pathway differs in the groups according to which differences in expression of activin- related genes and CYP17 were detected. First, hyperplastic adrenals have been exposed to increased ACTH concentrations and thus to high cAMP signalling. Second, significantly lower concentrations of cAMP response element-binding protein (CREB), an important transcription factor in the cAMP pathway, have been found in adren- ocortical carcinomas compared to adenomas.40 Third, altered cAMP signalling was shown by Peri et al.41 in human adrenocortical carci- noma samples and by Groussin et al.42 in the H295R cell line due to decreased ACTH receptor expression and loss of expression of CREB and of inducible cAMP early repressor isoforms (ICERs). The car- cinomas thus show lower expression of PKA regulated genes when compared with normal and hyperplastic adrenals. We speculate that CYP17, inhibin o-subunit, follistatin, ActRIIA, ActRIIB and betagly- can in the adrenal cortex and its malignant tumours are collectively controlled by cAMP, under the influence of ACTH. This relationship probably also applies to the adrenocortical adenomas, although no definitive conclusion can be made because of the small number of adenoma samples in our study. The subsequent effects of these differential expression patterns in the different types of adrenocortical tissues require further study.
As expected, we detected a higher expression of CYP17 mRNA in normal and hyperplastic adrenocortical samples compared to the carcinomas. CYP17 performs the second step in the steroidogenesis of glucocorticoids and androgens.43 Its function is therefore relevant to tumours in the adrenal cortex. Adrenocortical carcinomas secrete normal or elevated amounts of glucocorticoids and androgens into
the bloodstream while their mass normally exceeds that of the other tumours or normal adrenals, leading to the conclusion that the hormone secretion per cell is decreased in these tumours.4
In conclusion, we detected expression of inhibin a-, BA- and BB- subunits, follistatin, ActRIIA, ActRIIB, Alk-4 and betaglycan in normal and hyperplastic adrenals, adrenocortical adenomas and carcinomas, indicating full potential for activin and inhibin signalling in these tissues. The inhibin o-subunit was not detected in three carcinoma samples and inhibin BA-subunit mRNA was found to be slightly decreased in the carcinomas, suggesting that tumour formation in carcinomas might have been caused by loss of expression of the a-subunit or decreased BA-subunit expression. Significant differ- ences in expression between groups were detected for CYP17 and several genes in the activin/inhibin signal transduction pathway, suggesting involvement of changes in the activity of the cAMP signal transduction pathway. This study suggests that inhibin and activin signalling is dependent on tumour status of the adrenal cortex and may itself play a role in tumour formation.
Acknowledgements
We thank Dr John Foekens for donating the ECC-1 cell line, Dr Jenny Visser for revising the manuscript and Prof. Dr Theo Stijnen for help with the statistical analyses.
References
1 Kloos, R.T., Gross, M.D., Francis, I.R., Korobkin, M. & Shapiro, B. (1995) Incidentally discovered adrenal masses. Endocrine Reviews, 16, 460-484.
2 National Institutes of Health (2002) NIH State-of-the-Science State- ment on management of the clinically inapparent adrenal mass (‘incidentaloma’). NIH Consensus State-of-the-Science Statements, 19, 1-25.
3 Arnaldi, G., Masini, A.M., Giacchetti, G., Taccaliti, A., Faloia, E. & Mantero, F. (2000) Adrenal incidentaloma. Brazilian Journal of Med- ical and Biological Research, 33, 1177-1189.
4 Latronico, A.C. & Chrousos, G.P. (1997) Extensive personal experi- ence: adrenocortical tumors. Journal of Clinical Endocrinology and Metabolism, 82, 1317-1324.
5 Bornstein, S.R., Stratakis, C.A. & Chrousos, G.P. (1999) Adrenocor- tical tumors: recent advances in basic concepts and clinical manage- ment. Annals of Internal Medicine, 130, 759-771.
6 Matzuk, M.M., Finegold, M.J., Mather, J.P., Krummen, L., Lu, H. & Bradley, A. (1994) Development of cancer cachexia-like syndrome and adrenal tumors in inhibin-deficient mice. Proceedings of the National Academy of Sciences of the United States of America, 91, 8817-8821.
7 de Jong, F.H. (1979) Inhibin - fact or artifact. Molecular and Cellular Endocrinology, 13, 1-10.
8 Risbridger, G.P., Schmitt, J.F. & Robertson, D.M. (2001) Activins and inhibins in endocrine and other tumors. Endocrine Reviews, 22, 836-858.
9 Pangas, S.A. & Woodruff, T.K. (2000) Activin signal transduction pathways. Trends in Endocrinology and Metabolism, 11, 309-314.
10 Lewis, K.A., Gray, P.C., Blount, A.L., MacConell, L.A., Wiater, E., Bilezikjian, L.M. & Vale, W. (2000) Betaglycan binds inhibin and can mediate functional antagonism of activin signalling. Nature, 404, 411-414.
@ 2006 The Authors
11 Martens, J.W., de Winter, J.P., Timmerman, M.A., McLuskey, A., van Schaik, R.H., Themmen, A.P. & de Jong, F.H. (1997) Inhibin inter- feres with activin signaling at the level of the activin receptor complex in Chinese hamster ovary cells. Endocrinology, 138, 2928-2936.
12 Nakamura, T., Takio, K., Eto, Y., Shibai, H., Titani, K. & Sugino, H. (1990) Activin-binding protein from rat ovary is follistatin. Science, 247, 836-838.
13 Welt, C., Sidis, Y., Keutmann, H. & Schneyer, A. (2002) Activins, inhibins, and follistatins: from endocrinology to signaling. A para- digm for the new millennium. Experimental Biology and Medicine (Maywood), 227, 724-752.
14 Haji, M., Nishi, Y., Tanaka, S., Ohashi, M., Sekiya, K., Hasegawa, Y., Igarashi, M., Sasamoto, S. & Nawata, H. (1991) Evidence for the secretion of inhibin-like immunoreactivity from cultured human adrenal cells. Journal of Endocrinology, 128, R13-R16.
15 McCluggage, W.G., Burton, J., Maxwell, P. & Sloan, J.M. (1998) Immunohistochemical staining of normal, hyperplastic, and neoplastic adrenal cortex with a monoclonal antibody against alpha inhibin. Journal of Clinical Pathology, 51, 114-116.
16 Munro, L.M., Kennedy, A. & McNicol, A.M. (1999) The expression of inhibin/activin subunits in the human adrenal cortex and its tumours. Journal of Endocrinology, 161, 341-347.
17 Spencer, S.J., Rabinovici, J., Mesiano, S., Goldsmith, P.C. & Jaffe, R.B. (1992) Activin and inhibin in the human adrenal gland. Regulation and differential effects in fetal and adult cells. Journal of Clinical Investigation, 90, 142-149.
18 Vanttinen, T., Kuulasmaa, T., Liu, J. & Voutilainen, R. (2002) Expression of activin/inhibin receptor and binding protein genes and regulation of activin/inhibin peptide secretion in human adrenocortical cells. Journal of Clinical Endocrinology and Metabolism, 87, 4257-4263.
19 Vanttinen, T., Liu, J., Kuulasmaa, T., Kivinen, P. & Voutilainen, R. (2003) Expression of activin/inhibin signaling components in the human adrenal gland and the effects of activins and inhibins on adrenocortical steroidogenesis and apoptosis. Journal of Endocrinology, 178, 479-489.
20 Voutilainen, R., Eramaa, M. & Ritvos, O. (1991) Hormonally regu- lated inhibin gene expression in human fetal and adult adrenals. Journal of Clinical Endocrinology and Metabolism, 73, 1026-1030.
21 Arola, J., Liu, J., Heikkila, P., Ilvesmaki, V., Salmenkivi, K., Voutilainen, R. & Kahri, A.I. (2000) Expression of inhibin alpha in adrenocortical tumours reflects the hormonal status of the neoplasm. Journal of Endocrinology, 165, 223-229.
22 Nishi, Y., Haji, M., Tanaka, S., Yanase, T., Takayanagi, R., Etoh, Y. & Nawata, H. (1992) Human recombinant activin-A modulates the steroidogenesis of cultured bovine adrenocortical cells. Journal of Endocrinology, 132, R1-R4.
23 Suzuki, J., Otsuka, F., Inagaki, K., Takeda, M., Ogura, T. & Makino, H. (2004) Novel action of activin and bone morphogenetic protein in regulating aldosterone production by human adrenocortical cells. Endocrinology, 145, 639-649.
24 Nishi, Y., Haji, M., Takayanagi, R., Yanase, T., Ikuyama, S. & Nawata, H. (1995) In vivo and in vitro evidence for the production of inhibin-like immunoreactivity in human adrenocortical adenomas and normal adrenal glands: relatively high secretion from adenomas manifesting Cushing’s syndrome. European Journal of Endocrinology, 132, 292- 299.
25 Rich, N., Gaston, V., Le Bouc, Y. & Gicquel, C. (2002) Expression of the gene for the alpha-subunit of inhibin in human adrenocortical tumours. Hormone Research, 57, 43-47.
26 van Slooten, H., Schaberg, A., Smeenk, D. & Moolenaar, A.J. (1985) Morphologic characteristics of benign and malignant adrenocortical tumors. Cancer, 55, 766-773.
27 Beuschlein, F., Looyenga, B.D., Bleasdale, S.E., Mutch, C., Bavers, D.L., Parlow, A.F., Nilson, J.H. & Hammer, G.D. (2003) Activin induces x-zone apoptosis that inhibits luteinizing hormone-dependent adrenocortical tumor formation in inhibin-deficient mice. Molecular and Cellular Biology, 23, 3951-3964.
28 He, Z.Y., Liu, H.C., Mele, C.A., Barmat, L., Veeck, L.L., Davis, O. & Rosenwaks, Z. (1999) Expression of inhibin/activin subunits and their receptors and binding proteins in human preimplantation embryos. Journal of Assisted Reproduction and Genetics, 16, 73-80.
29 Kananen, K., Markkula, M., Mikola, M., Rainio, E.M., McNeilly, A. & Huhtaniemi, I. (1996) Gonadectomy permits adrenocortical tum- origenesis in mice transgenic for the mouse inhibin alpha-subunit promoter/simian virus 40 T-antigen fusion gene: evidence for negative autoregulation of the inhibin alpha-subunit gene. Molecular Endo- crinology, 10, 1667-1677.
30 Salmenkivi, K., Arola, J., Voutilainen, R., Ilvesmaki, V., Haglund, C., Kahri, A.I., Heikkila, P. & Liu, J. (2001) Inhibin/activin betaB-subunit expression in pheochromocytomas favors benign diagnosis. Journal of Clinical Endocrinology and Metabolism, 86, 2231-2235.
31 Tricarico, C., Pinzani, P., Bianchi, S., Paglierani, M., Distante, V., Pazzagli, M., Bustin, S.A. & Orlando, C. (2002) Quantitative real- time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies. Analytical Biochemistry, 309, 293-300.
32 Wang, E.Y., Ma, E.Y. & Woodruff, T.K. (2003) Activin signal trans- duction in the fetal rat adrenal gland and in human H295R cells. Journal of Endocrinology, 178, 137-148.
33 Pelkey, T.J., Frierson, H.F. Jr, Mills, S.E. & Stoler, M.H. (1998) The alpha subunit of inhibin in adrenal cortical neoplasia. Modern Pathology, 11, 516-524.
34 Lund, J., Ahlgren, R., Wu, D.H., Kagimoto, M., Simpson, E.R. & Waterman, M.R. (1990) Transcriptional regulation of the bovine CYP17 (P-450(17)alpha) gene. Identification of two cAMP regulatory regions lacking the consensus cAMP-responsive element (CRE). Journal of Biological Chemistry, 265, 3304-3312.
35 DiMuccio, T., Mukai, S.T., Clelland, E., Kohli, G., Cuartero, M., Wu, T. & Peng, C. (2005) Cloning of a second form of activin-betaA cDNA and regulation of activin-betaA subunits and activin type II receptor mRNA expression by gonadotropin in the zebrafish ovary. General and Comparative Endocrinology, 143, 287-299.
36 Klaij, I.A., Toebosch, A.M., Themmen, A.P., Shimasaki, S., de Jong, F.H. & Grootegoed, J.A. (1990) Regulation of inhibin alpha- and beta B-subunit mRNA levels in rat Sertoli cells. Molecular and Cellular Endocrinology, 68, 45-52.
37 Liu, J., Kuulasmaa, T., Kosma, V.M., Butzow, R., Vanttinen, T., Hyden-Granskog, C. & Voutilainen, R. (2003) Expression of betagly- can, an inhibin coreceptor, in normal human ovaries and ovarian sex cord-stromal tumors and its regulation in cultured human granulosa- luteal cells. Journal of Clinical Endocrinology and Metabolism, 88, 5002-5008.
38 Pang, Y. & Ge, W. (2002) Gonadotropin regulation of activin betaA and activin type IIA receptor expression in the ovarian follicle cells of the zebrafish, Danio rerio. Molecular and Cellular Endocrinology, 188, 195-205.
39 Aloi, J.A., Marshall, J.C., Yasin, M., Gilrain, J.T., Haisenleder, D.J. & Dalkin, A.C. (1997) Ovarian activin receptor subtype and follistatin gene expression in rats: reciprocal regulation by gonadotropins. Biology of Reproduction, 56, 1565-1569.
40 Rosenberg, D., Groussin, L., Jullian, E., Perlemoine, K., Medjane, S., Louvel, A., Bertagna, X. & Bertherat, J. (2003) Transcription factor 3’,5’-cyclic adenosine 5’-monophosphate-responsive element-binding
protein (CREB) is decreased during human adrenal cortex tumori- genesis and fetal development. Journal of Clinical Endocrinology and Metabolism, 88, 3958-3965.
41 Peri, A., Luciani, P., Conforti, B., Baglioni-Peri, S., Cioppi, F., Crescioli, C., Ferruzzi, P., Gelmini, S., Arnaldi, G., Nesi, G., Serio, M., Mantero, F. & Mannelli, M. (2001) Variable expression of the transcription factors cAMP response element-binding protein and inducible cAMP early repressor in the normal adrenal cortex and in adreno- cortical adenomas and carcinomas. Journal of Clinical Endocrinology and Metabolism, 86, 5443-5449.
42 Groussin, L., Massias, J.F., Bertagna, X. & Bertherat, J. (2000) Loss of expression of the ubiquitous transcription factor cAMP response element-binding protein (CREB) and compensatory overexpression of the activator CREMtau in the human adrenocortical cancer cell line H295R. Journal of Clinical Endocrinology and Metabolism, 85, 345-354.
43 Miller, W.L. (1988) Molecular biology of steroid hormone synthesis. Endocrine Reviews, 9, 295-318.
44 Levine, A.C., Mitty, H.A. & Gabrilove, J.L. (1988) Steroid content of the peripheral and adrenal vein in Cushing’s syndrome due to adren- ocortical adenoma and carcinoma. Journal of Urology, 140, 11-15.
45 Hofland, L.J., van der Hoek, J., van Koetsveld, P.M., de Herder, W.W., Waaijers, M., Sprij-Mooij, D., Bruns, C., Weckbecker, G., Feelders, R., van der Lely, A.J., Beckers, A. & Lamberts, S.W. (2004) The novel somatostatin analog SOM230 is a potent inhibitor of hormone release by growth hormone- and prolactin-secreting pituitary ade- nomas in vitro. Journal of Clinical Endocrinology and Metabolism, 89, 1577-1585.
46 Fallo, F., Pezzi, V., Barzon, L., Mulatero, P., Veglio, F., Sonino, N. & Mathis, J.M. (2002) Quantitative assessment of CYP11B1 and CYP11B2 expression in aldosterone-producing adenomas. European Journal of Endocrinology, 147, 795-802.