7. Reiter A, Schrappe H, Parwaresch R, et al. Non-Hodgkin’s lymphomas of childhood and adolescence: Results of a treat- ment stratified for biologic subtypes and stage-A report of the Berlin-Frankfurt-Münster Group. J Clin Oncol 1995;13:359-372.
8. Cupisti A, Riccioni R, Carulli G, et al. Bilateral primary renal lymphoma treated by surgery and chemotherapy. Nephrol Dial Transplant 2004;19:1629-1633.
9. Arranz Arija J, Carrion JR, Garcia FR, et al. Primary renal lymphoma. Report of three cases and review of literature. Am J Nephrol 1994;14:148-153.
10. Vujanic GM, Webb D, Kelsey A. B-Cell non-Hodgkin’s lymphoma presenting as a primary renal tumor in a child. Med Pediatr Oncol 1995;25:423-426.
11. Chio JH, Choi GB, Shim KN, et al. Bilateral primary renal non- Hodgkin’s lymphoma presenting with acute renal failure: Suc- cessful treatment with systemic chemotherapy. Acta Haematol 1997;97:231-235.
12. Lowe LH, Isuani BH, Heller RM, et al. Pediatric renal masses: Wilms’ tumor and beyond. Radiographics 2000;20:1585-1603.
13. Okuno SH, Hoyer JD, Ristow K, et al. Primary renal non-Hodgkin’s lymphoma. Cancer 1995;75:2258-2261.
14. Cruz Villalón F, Escribano Fernandez J, Ramirez García T. The hypoechoic halo: A finding in renal lymphoma. J Clin Ultrasound 1995;23:379-381.
15. Chepuri NB, Strouse PJ, Yanik GA. CT of renal lymphoma in children. Am J Roentgenol 2003;180:429-431.
16. Hemmaway C, Walker MM, Deal J, et al. Teaching cases from the Royal Marsden and St. Mary’s Hospitals case 25. A young boy with massive bilateral renal enlargement. Leuk Lymphoma 2004; 45:1301-1303.
17. Yasunaga Y, Hoshida Y, Hashimoto M, et al. Malignant lymphoma of the kidney. J Surg Oncol 1997;64:207-211.
18. Ferry JA, Harris NL, Papanicolaou N, et al. Lymphoma of the kidney. A report of 11 cases. Am J Surg Pathol 1995;19:134- 144.
19. Kandel LB, Mccullough DL, Harrison LH, et al. Primary renal lymphoma: Does it really exist? Cancer 1987;60:386-391.
20. Harris GJ, Lager DJ. Primary renal lymphoma. J Surg Oncol 1991;46:273-277.
21. Farrow GM, Harrison EG, Utz DC. Sarcomatous and sarcomatoid and mixed malignant tumors of the kidney in adults. II. Cancer 1968;22:551-555.
22. Aozasa K, Inoue A, Tajima K, et al. Malignant lymphomas of the thyroid gland: Analysis of 79 patients with emphasis on histologic prognostic factors. Cancer 1986;58:100-104.
23. Parsonnet J, Hansen S, Rodriguez L, et al. Helicobacter pylori infection and gastric lymphoma. N Engl J Med 1994;330:1267- 1271.
24. Schmid U, Helbron D, Lennert K. Primary malignant lymphomas localized in salivary gland. Histopathology 1982;6:673-676.
25. Betta PG, Bottero G, Cosini MF, et al. Primary renal lymphoma. Eur Urol 1986;12:352-354.
Early Detection of Adrenocortical Carcinoma in a Child With Li-Fraumeni Syndrome
Ming-Tsan Lin, MD,1,2* Jeng-Jer Shieh, PhD,3,4 Julia Hui-Mei Chang, MD,5 Shih-Wen Chang, MD,6 Tse-Ching Chen, MD, PHD,7 and Wen-Hu Hsu, MD8
We report an early detection of cancer in a child with Li- Fraumeni syndrome. The proband was a 3-year-old male with a primitive mesenchymal tumor. Genetic analysis showed a germline TP53 mutation in codon 220 exon 6, which changed TAT → TGT and resulted in a tyrosine-to-cysteine amino acid substitution (Tyr220Cys). The younger sister at risk was followed, and an
asymptomatic adrenal cortical carcinoma was detected 3 years later. The report highlights the importance of genetic counseling and provides an example of early detection of cancers in childhood LFS carriers. Pediatr Blood Cancer 2009;52:541-544. @ 2008 Wiley-Liss, Inc.
Key words: carrier screen; childhood; genetic counseling; Li-Fraumeni syndrome; p53 mutation
INTRODUCTION
The familial cancer syndrome termed Li-Fraumeni syndrome (LFS) is characterized by unusual familial clustering of tumors including soft tissue sarcoma, early onset breast cancer, brain tumors, leukemia, and childhood adrenocortical tumors [1]. Molecular studies have identified the p53 gene mutation as a major causative factor of LFS [2]. One study showed that there was an estimated risk of 41% for males with a p53 mutation to develop cancers before age 45, but the same risk for females was 84% [3]. Lifetime risk has been reported to be 70-90% for males, and nearly 100% for females, especially of early onset breast cancer [3]. We describe an LFS family with a germline p53 exon 6 mutation. Through close follow-up, an asymptomatic stage I adrenocortical carcinoma in the younger sister at risk was detected.
@ 2008 Wiley-Liss, Inc. DOI 10.1002/pbc.21836
Published online 22 December 2008 in Wiley InterScience (www.interscience.wiley.com)
—
1Department of Pediatrics, Changhua Christian Hospital, Changhua, Taiwan; 2Department of Pediatrics, National Cheng-Kung University School of Medicine, Tainan, Taiwan; 3Institute of Medical Technology, National Chung Hsing University, Taichung, Taiwan; 4Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan; 5Department of Pathology, Changhua Christian Hospital, Changhua, Taiwan; ‘Department of Surgery, Changshan Medical University Hospital, Taichung, Taiwan; 7Department of Pathology, Chang Guan Memorial Hospital, LinKou, Taiwan; 8Division of Thoracic Surgery, Department of Surgery, Taipei Veterans General Hospital, and National Yang-Ming University School of Medicine, Taipei, Taiwan
Grant sponsor: Changhua Christian Hospital Research; Grant number: C950030.
*Correspondence to: Ming-Tsan Lin, Department of Pediatrics, Changhua Christian Hospital, 135 Nan-Siau Street, Changhua 500, Taiwan. E-mail: mtsy@ms18.hinet.net
Received 13 June 2008; Accepted 24 September 2008
Brief Reports
CASE REPORT
The proband was a 3-year-old male who was diagnosed with a stage IV primitive mesenchymal tumor. His paternal uncle was diagnosed with a gastrointestinal stromal tumor at 46 years of age, and a paternal grand uncle was affected by colon cancer at the age of 55 years. His maternal grandfather died from pancreatic cancer, and the grandmother’s brother developed a hepatoma. Two years after the proband’s diagnosis, his 38-year-old father developed a lung cancer. The familial clustering of cancers and young age of cancer onset in the family suggested LFS.
The younger sister of the proband was closely followed. The sister received comprehensive physical examinations, routine hematological and urine tests every 2 months, biochemical tests every 4 months, tumor marker testing such as CA125, CA99, alpha- fetal protein, carcinoembryonic antigen, chest roentgenography and abdominal ultrasonography every 6 months. At 5 years of age, a right upper abdominal mass was palpated on a routine visit. A magnetic resonance image study revealed a 6 cm x 6 cm × 7 cm right suprarenal tumor. The well-encapsulated suprarenal tumor was completely removed. Pathologic examination revealed adrenocort- ical carcinoma.
The study has been approved by the Institutional Review Board of Changhua Christian Hospital, and informed consents were obtained from all patients for the molecular studies. The P53 exons 2 through 11 were analyzed by polymerase chain reaction and direct sequencing. Automatic sequencing showed a mutation in codon 220 exon 6, which changed TAT -+ TGT and resulted in a tyrosine- to-cysteine amino acid substitution (Tyr220Cys; Fig. 1). Pedigree analysis and molecular investigation favored LFS of the paternal side (Fig. 2). A TP53 germline mutation was demonstrated in subjects II-3, III-1, and III-2 but not in 40 other family members. The
proband died 2 years later but the sister has been well until the present.
DISCUSSION
P53 germ line mutations have been detected in approximately 71% of the LFS families and 22% of LFS-like patients [4]. Analysis of the TP53 gene of our study showed a germline mutation in the proband (III-1), the sister (III-2), and the proband’s father (II-3) but not in the grandparents. The mutation must therefore have arisen de novo in the father (II-3).
For families with LFS, negative molecular testing may relieve anxiety. If they are found to carry a mutation, genetic counseling is extremely important, as carriers may benefit from early detection of cancers. However, genetic counseling and screening of cancers in individuals with LFS are complex and difficult because of the broad range of primary cancers that develop, the variation of clinical presentation within and between LFS families, and the fact that cancers may occur at any age [5].
A greater than 100-fold higher risk of sarcoma, female breast cancer and hematological malignancies has been demonstrated in persons with p53 mutations [6]. Among individuals diagnosed with LFS and cancer, 15% developed a second cancer, 4% had a third cancer, and 2% developed a fourth cancer [5]. Relative risk of second cancers was 83% for LFS patients with a first cancer developing between ages 0-19 years, and relative risks were 9.7% and 1.5% for those first cancers occurring between 20-40 and 45 years or more, respectively [5]. Thus, screening for early detection of primary cancers in individuals at risk, and the possible development of subsequent cancers in cancer survivors with LFS are of equal importance.
Proband: Mesenchymal tumor
III-2 Adrenal corticocarcinoma
Exon 6F 160
Exon 6R
170 GGTGGTGCCCTGTGAGCCGCC
Exon 6F 160 GTGGTGGTGCCCTGTGAGCCG 170
Exon 6R 190
GGIGGTG CC CTGTG AGC C GC C
190
200
200 GTGGTGCC CTGTGAGCCGCC1
MEN
DOMANDAON!
AN
MAINLY
Tumor
GGTGCCCTGTGAGCCGCC
160
GGTGCC C TAIGI GCCGCC
190
200
160 GTGGIGGTGCCCTGTGAGCCC 170
GTGGIG CCC TATGAGCCGCC
190
200
JIE
DODANO
MICHAEL
Blood
I
1
2
3
4
5
6
7
8
9
10
11
*
*
*
*
*
*
*
*
p53 wwwI
Colon(55) p53 wwwI
p53 www.
p53 wwwl
Liver
Pancreas
II
1
*
2
*
3
*
4
*
5
6
7
*
*
GIST (46) p53 wwwl
Lung (38) PB:p53w/mul
Tumor:p53 wimul
p53 www.
III
1
*
2
*
5
Mesenchyme (3)
Adrenal (5) PB: p53wimui Tumor:53wimul
PB: p53wimul
Tumor p53mulmul
With the exception of breast cancer screening, no surveillance measurements have been shown to reduce morbidity or mortality in patients with LFS. The National Comprehensive Cancer Network guidelines (http://www.nccn.org) provide a screening program for adults with LFS. Recommendations include annual comprehensive physical examinations, colonoscopy every 2-5 years, and addi- tional organ-targeted surveillance based on family history as well as breast examinations starting from 18 years of age. Masciari et al. [7] reported a FDG PET-CT screening that uncovered 3 cancers in a cohort of 15 asymptomatic LFS mutation carriers who did not show any signs of cancer upon a physical examination.
Diagnostic radiological procedures may be associated with an increasing risk of cancer, and genetic factors may play a role in this risk association [8]. Increased radiosensitivity has been observed in individuals with LFS [9,10] and more so in children than in adults [11]. Radiation should be avoided as much as possible. The clinical applications of FDG-PET for cancer patients have expanded remarkably during the last decade [12]. A definitive conclusion on the potential cancer risk that may result from using PET for cancer surveillance cannot be made because of the variable uptake of radiotracers in some cancers, insufficient specificity, risk of radiation exposure, and cost-effectiveness considerations [13]. A CT scan exposes a patient to 100 times more radiation than regular chest X-rays. Also, with repeated CT exposure, the collective dose can often approach or exceed the level known to increase the probability of cancer. The role of routine mammography in women with LFS is controversial because the risk of carcinogenesis may be greater than the potential benefit [14].
Kuhl et al. [15] reported that mammography, ultrasonography, and MRI detected breast cancer at rates of 2.6%, 3.2%, and 7.4%,
respectively. The American Cancer Society recommends an annual breast MRI screening for anyone affected by LFS and their first- degree relatives [16]. The value of a breast MRI lies in the increased sensitivity, which ranges from 71% to 100%, while the sensitivity of mammography is only 16-40%. The drawback is its high cost, and the slightly lower specificity of MRI as compared to mammography [17]. Thus, MRI is considered as a complement to mammography, not a replacement at present [16]. Updated software systems and technologies have been developed to improve MRI specificity without a resultant decrease in its sensitivity [18,19].
Although it has a lower sensitivity, ultrasonography may be recommended for a systemic survey procedure owing to its lack of carcinogenic effects, relatively low cost, and availability. Invasive, costly, and high-dose radiological diagnostic tools such as endos- copies, CT scans, and PET studies are indicated only in some individuals and at a physician’s discretion. A thorough medical history, a periodical comprehensive physical examination, and basic laboratory and traditional imaging studies are reasonable life-long strategies for the early detection of cancers in children at risk for LFS.
ACKNOWLEDGMENT
The authors would like to acknowledge the courage and cooperation of the family described in this study. Thanks also to Ms. Chin-Wen Yang, Department of Medical Genetics, Changhua Christian Hospital, for the molecular analysis assistance. This work was supported by Changhua Christian Hospital Research grant C950030.
REFERENCES
1. Li FP, Fraumeni JF. Soft-tissue sarcoma, breast cancer, and other neoplasms-A familial syndrome? Ann Intern Med 1969;71:747- 752.
2. Malkin D, Li FP, Strong LC, et al. Germ line p53 mutations in a familial syndrome of breast, sarcomas and other neoplasms. Science 1990;250:1233-1238.
3. Chompret A, Brugières L, Ronsin M, et al. P53 germline mutations in childhood cancers and cancer risk for carrier individuals. Br J Cancer 2000;82:1932-1937.
4. Varley JM, McGown G, Thorncroft M, et al. Germ-line mutations of the TP53 in Li-Fraumeni families: An extended study of 39 families. Cancer Res 1997;57:3245-3252.
5. Hisada M, Garber JE, Fung CY, et al. Multiple primary cancers in families with Li-Fraumeni syndrome. J Natl Cancer Inst 1998;90: 606-611.
6. Hwang SJ, Lozano G, Amos CI, et al. Germline p53 mutations in a cohort with childhood sarcoma: Sex differences in cancer risk. Am J Hum Genet 2003;72:975-983.
7. Masciari S, van den Abbeele AD, Diller LR, et al. F18- Fluorodeoxyglucose-Positron emission tomography/computed tomography screening in Li-Fraumeni syndrome. JAMA 2008; 299:1315-1319.
8. Myles P, Evans S, Lophatananon A, et al. Diagnostic radiation procedures and risk of prostate cancer. Br J Cancer 2008;98:1852- 1856.
9. Limacher JM, Frebourg T, Natarajan-Ame S, et al. Two metachronous tumors in the radiotherapy fields of a patient with Li-Fraumeni syndrome. Int J Cancer 2001;96:238-242.
10. Boyle JM, Spreadborough AR, Greaves MJ, et al. Delayed chromosome changes in gamma-irradiated normal and Li- Fraumeni fibroblasts. Radiat Res 2002;157:158-165.
11. Hall EJ, Brenner DJ. Cancer risks from diagnostic radiology. Br J Radiol 2008;81:362-378.
12. Juweid ME, Cheson BD. Positron-emission tomography and assessment of cancer therapy. N Engl J Med 2006;354:496- 507.
13. Kojima S, Zhou B, Teramukai S, et al. Cancer screening of healthy volunteers using whole-body 18F-FDG-PET scans: The Nishidai clinic study. Eur J Cancer 2007;43:1842-1848.
14. Eng C, Hampel H, de la Chapelle A, et al. Testing for cancer predisposition. Annu Rev Med 2000;52:371-400.
15. Kuhl CK, Schmutzler RK, Leutner CC, et al. Breast MR imaging screening in 192 women proved or suspected to be carriers of a breast cancer susceptibility gene: Preliminary results. Radiology 2000;215:267-279.
16. Saslow D, Boetes C, Burke W, et al. American Cancer Society guidelines for breast screening with MRI as an adjunct to mammography. CA Cancer J Clin 2007;57:75-89.
17. Lehman CD. Screening MRI for women at high risk for breast cancer. Semin Ultrasound CT MRI 2006;27:333- 338.
18. Lehman CD, Peacock S, DeMartini WB, et al. A new automated software system to evaluate breast MR examinations: Improved specificity without decreased sensitivity. Am J Roentgenol 2006; 187:51-56.
19. Pirollo KF, Dagata J, Wang P, et al. A tumor-targeted nanodelivery system to improve early MRI detection of cancer. Mol Imaging 2006;5:41-52.
Therapy and Outcome of Orbital Primitive Neuroectodermal Tumor
Sameer Bakhshi, MD,1,2,3* Rachna Meel, MD,3,4,5 Syed Ghaffar Hasan Naqvi, MBBS,1,2,3 B.K. Mohanti, MD,2,3,6 Seema Kashyap, MD,3,5,7 Neelam Pushker, Ms,3,4,5 and Seema Sen, MD3,5,7
Primary orbital primitive neuroectodermal tumor (PNET) is rare with no reported series. We report six cases of orbital PNET treated at a tertiary care oncology center in northern India from 2003 to 2008. None of them had distant metastases. All were treated with neoadjuvant chemotherapy followed by exenteration in two, radio- therapy and adjuvant chemotherapy in five cases. Three out of six
achieved complete remission at end of therapy with globe salvage in three and vision in two cases. Chemoradiotherapy may help us to avoid mutilating surgery in large or locally advanced tumors, allowing preservation of vision or the globe. Pediatr Blood Cancer 2009;52:544-547. @ 2008 Wiley-Liss, Inc.
Key words: Ewing sarcoma; orbit; primitive neuroectodermal tumor; therapy
INTRODUCTION
Peripheral primitive neuroectodermal tumor (PNET) along with Ewing sarcoma is clubbed under the Ewing sarcoma family of tumors [1]. Peripheral PNET is a group of soft tissue malignancies that usually affects children and adolescents and represents 4% of all childhood and adolescent soft tissue tumors [2-4]. It is most commonly seen in the thoracopulmonary region followed by head and neck region [5]. Primary PNET in the orbit are rare with only 10 cases reported in English literature to the best of our knowledge [6-14].
METHODS
Retrospective data analysis of primary orbital PNET treated at a tertiary care cancer center of All India Institute of Medical Sciences, between June 2003 and June 2008, was undertaken. Patient’s
Additional Supporting Information may be found in the online version of this article.
1Department of Medical Oncology, New Delhi, India; 2Dr B.R.A. Institute Rotary Cancer Hospital, New Delhi, India; 3 All India Institute of Medical Sciences, New Delhi, India; 4Oculoplastics & Ocular Oncology Service, New Delhi, India; 5Dr. Rajendra Prasad Centre for Ophthalmic Sciences, New Delhi, India; ‘Department of Radiotherapy, New Delhi, India; 7Ocular Pathology Services, New Delhi, India
*Correspondence to: Sameer Bakhshi, Associate Professor of Pediatric Oncology, Department of Medical Oncology, Dr B.R.A. Institute Rotary Cancer Hospital, All India Institute of Medical Sciences, New Delhi, India. E-mail: sambakh@hotmail.com
Received 9 September 2008; Accepted 12 November 2008
@ 2008 Wiley-Liss, Inc.
DOI 10.1002/pbc.21902
Published online 17 December 2008 in Wiley InterScience (www.interscience.wiley.com)