Modified high-density lipoprotein modulates aldosterone release through scavenger receptors via extra cellular signal-regulated kinase and Janus kinase-dependent pathways
Sarama Saha · Juergen Graessler . Peter E. H. Schwarz · Claudia Goettsch · Stefan R. Bornstein · Steffi Kopprasch
Received: 7 December 2011 / Accepted: 16 February 2012/Published online: 1 March 2012 @ Springer Science+Business Media, LLC. 2012
Abstract Patients with type 2 diabetes (T2D) manifest significant abnormalities in lipoprotein structure and function. The deleterious impact of oxidative and glycoxidative modi- fications on HDL-mediated atheroprotective, antiinflamma- tory, and antioxidative phenomena has been well established. However, the biological effects of modified HDL on adrenal steroidogenesis-which could reveal a pathophysiological link to the overactivity of the renin-angiotensin-aldosterone system and its adverse cardiovascular consequences often observed in T2D-are not well delineated. We studied the role of modified HDL on aldosterone release from adrenocortical carcinoma cells (NCI-H295R). In vitro modifications of native HDL were performed in the presence of glucose for glycoxidized HDL (glycoxHDL) and sodium hypochlorite for oxidized HDL. Angiotensin II (AngII)-sensitized H295R cells were treated with lipoproteins for 24 h, and supernatant was used to measure aldosterone release. Both native and modified HDL augmented the steroid release from AngII-sensitized cells, with glycoxHDL having the greatest impact. Both the modified forms of HDL induced a significant increase in scavenger receptor expression and employed protein kinase C as well as extracellular signal-regulated kinase as downstream effectors of aldosterone release. Native HDL and modified HDL required Janus kinase-2 for combating increased demand in steroidogenesis. Therefore, our data support the hypothesis that diabetes-induced modification of HDL may promote adrenocortical aldosterone secretion via different signal transduction pathways. This significant influence on
S. Saha ☒ . J. Graessler . P. E. H. Schwarz . C. Goettsch .
S. R. Bornstein · S. Kopprasch
Department of Internal Medicine III, Carl Gustav Carus Medical School, Technical University of Dresden, Fetscherstraße 74, 01307 Dresden, Germany
multiple signaling mechanisms could be targeted for future research to implement novel therapeutic trials.
Keywords HDL . Aldosterone . Glycoxidation . Oxidation · Mitogen activated protein kinase · Janus kinase
Introduction
An inverse relationship between high-density lipoprotein (HDL) cholesterol concentration and the incidence of ath- erosclerosis has been established. This anti-atherogenic potentiality of HDL is implicated by its pivotal role in transporting cholesterol from peripheral tissues to the liver, a multi-step process known as reverse cholesterol transport [1, 2], as well as by its anti-oxidative, anti-inflammatory, anti-apoptotic, anti-thrombotic, and vasodilatory action [3].
In addition to its anti-atherosclerotic effects, HDL con- tributes its cholesterol content as a major source of precursor for steroidogenesis in tissues, such as adrenal cortex, testis, and ovary. Steroidogenic cells can process large quantities of HDL-derived cholesterol esters (CE) through the “selec- tive” cholesteryl ester uptake pathway via scavenger receptor class B, type I (SR-BI) [4, 5] without internalization or degradation of the receptor protein. Furthermore, it has been documented that angiotensin II (AngII), a physiologic regulator of aldosterone synthesis, enhances selective uptake of SR-BI-mediated HDL CE in bovine adrenal glomerulosa cells [6]. Aldosterone, a component of the renin-angioten- sin-aldosterone system (RAAS), plays an important physi- ological role in maintaining fluid-electrolyte homeostasis, whereas the overproduction of aldosterone causes several deleterious effects on heart, kidney, and vessels, which are especially more pronounced in case of patients with type 2
diabetes mellitus (T2D) [7-9]. In an experimental animal model, it has been demonstrated that over-activity of the RAAS contributes to the pathological consequences of pre- diabetes and T2D by decreasing insulin sensitivity [10].
Epidemiological studies have revealed that cardiovas- cular morbidity and mortality are greatly increased in patients with poorly controlled T2D [11]. Hyperglycemia, a characteristic feature of T2D, leads to non-enzymatic glycation and glycoxidation of circulating proteins including plasma lipoproteins, resulting in formation of advanced glycation end (AGE) products, such as Ne-(car- boxymethyl)lysine (CML) and Ne-(carboxyethyl)lysine (CEL), and specific amino acid oxidation products [12, 13].
Oxidative stress is commonly associated with impaired glucose tolerance (IGT) and T2D. Compelling supporting evidence of increased levels of circulating oxidized LDL [14, 15] and glycoxidized LDL [12] has been documented. Studies with in vitro oxidized LDL revealed that mild oxidation sensitized adrenocortical cells to AngII for fur- ther stimulation, whereas extensive LDL oxidation reduced adrenal aldosterone release [16]. A recent study demon- strated that prediabetic and diabetic in vivo modification of circulating LDL attenuated its stimulating effect on adrenal aldosterone and cortisol secretion [17].
Glucose-induced modification of HDL is considered to cause impairment of HDL’s protective effects against atherosclerosis. This is due to its inability to promote cholesterol efflux following glycation of apolipoprotein (apo) A-I as demonstrated in macrophages and HeLa cells [18], altered activity of lecithin cholesterol acyltransferase [19], and deficient anti-oxidative activity of its enzyme paraoxonase-1 [20].
Several independent studies of small sample size reported a negative association between plasma aldoste- rone and HDL cholesterol levels [21-23]. In the Fra- mingham Heart Study, however, no direct correlation between these two parameters was found with larger sample size [24]. Very recently, Xing et al. [25] demon- strated that HDL can act as a signaling molecule, and HDL-induced aldosterone secretion is mediated by SR-BI. Although several studies have been carried out with natHDL, minimum effort has been devoted to exploring the effects of glycoxidized HDL (glycoxHDL) and oxidized HDL (oxHDL) on steroidogenesis. Therefore, the purpose of the present study was to evaluate the effects of in vitro glycoxidized and oxidized HDL on adrenal aldosterone synthesis at the molecular level using AngII-sensitized and -nonsensitized human adrenocortical cell line (NCI- H295R) to appreciate the impact of glycoxidation and oxidation of lipoproteins on possible aldosterone-mediated pathophysiological consequences of T2D. Furthermore, we sought to identify probable signaling mechanisms includ- ing effects on scavenger receptor, SR-BI.
Experimental
Preparation of HDL
NatHDL was isolated from ethylene diamine tetra acetic acid (EDTA) blood of overnight fasting healthy normo- lipidemic volunteers using very fast density gradient ultracentrifugation [26]. Protein content of HDL was equalized to 0.6 g/l after dilution with phosphate buffered saline (PBS). Subsequently, HDL was glycoxidized in the presence of 200 mmol/l of glucose for 6 days followed by dialysis to remove the excess glucose. Oxidation of HDL was accomplished by incubating natHDL with sodium hypochlorite at a final concentration of 3 mmol/l at 37℃ for 40 min.
Biochemical characterization of native, glycoxidized, and oxidized HDL
The glucose- and hypochlorite-induced HDL protein modification was assessed by determination of fluorescent products with an emission maximum at 430 nm when excited at 365 nm [27] by carbonyl formation [28], and by determination of Ne-(carboxymethyl)lysine (CML) levels (ELISA, Microcoat, NJ/USA). Oxidative and glycoxidative changes in the HDL lipid fractions were measured by accumulation of thiobarbituric acid-reactive substances (TBARS) as described by Yagi [29].
Cell culture
H295R human adrenocortical cells were cultured in DMEM (Sigma)/F12 (Invitrogen) medium, supplemented with Insulin (66 umol/l), Hydrocortisone (10 umol/1), 17 estradiol (10 µmol/l), apo-transferrin (10 µg/ml), sodium selenite (30 umol/l), and 2% FCS (Biochrom) along with penicillin (100 units) and streptomycin (100 µg/ml) at 37°℃ in a humidified atmosphere of 95% air with 5% CO2. Cells were seeded at a density of 70,000 cells per cm2 on six-well plates and 48-well plates for the subsequent experiments. 80% confluent cells were then subjected to treatment with AngII for 24 h, followed by natHDL, glycoxHDL, or oxHDL for the next 24 h in serum-free media (SFM) to measure aldosterone released in the media as well as protein extraction and RNA isolation. During evaluation of signaling mechanism, cells (not sensitized with AngII) were treated with different forms of lipopro- teins in the presence or the absence of specific blockers for 24 h to obtain exclusive effects of lipoproteins. Moreover, it is to be noted that following treatment with specific inhibitors the viability of the cells remained unaffected. Specific pharmacological inhibitors, such as
U0126 (1,4-Diamino-2,3-dicyano-1,4-bis(2aminophenylthio) butadiene), SB203580(4-(4-Fluorophenyl)-2-(4-methylsulfinyl- phenyl)-5-(4-pyridyl)1H-imidazole, HCl), Bisindolylmaleim- ide I (2-[1-(3-Dimethylaminopropyl)-1H-indol-3-yl] -3-(1H- indol-3-yl) maleimide, HCl), LY294002 (2-(4-Morpholinyl)-8- phenyl -4H-1-benzopyran-4-one), and AG490 (NBenzyl-3, 4-dihydroxy-«-cyanocinnamide) were obtained from Calbio- chem (Darmstadt, Germany). BLT-1 (Block Lipid Transport-1, 2-Hexyl-1-cyclopentanone thiosemicarbazone) was obtained from Chembridge Corporation (San Diego, CA, USA).
Western blotting
After specific treatment, cells were suspended with ice-cold cell lytic M reagent (Sigma), containing 1% (v/v) protease inhibitor cocktail (Sigma-Aldrich). The whole-cell lysates containing 10 µg of protein, quantified by bicinchoninic
TM acid (BCA) protein assay kit (Pierce, USA), was resolved by electrophoresis [30] following denaturation. The sepa- rated protein was electrophoretically transferred onto a polyvinylidene difluoride membrane (Roti-PVDF). Fol- lowing incubation with blocking solution, membranes were probed with different antibodies against specific proteins, such as SR-BI (1:10,000, Novus Biologicals, Cat. No NB (400-101)), phospho-extracellular signal regulated kinases (PERK) 42/44 (Cell Signaling Technology, Germany Cat. No 9101), and phospho-signal transducer and activator of transcription (pSTAT3 Tyr 705) (1:1,000, Cell Signaling Technology, Germany Cat. No. 9145). ß-Actin antibody (1:1,000, Cell Signaling Technology, Cat. No. 4967) was used as a control to normalize the protein content in dif- ferent lanes. The membranes were then reacted with per- oxidase-conjugated secondary antibody (Bio Rad, 1:6,000), and the signals were visualized by chemiluminescence reactions using Supersignal West Pico Chemiluminescent substrate kit (Pierce), and the Gene Genome bio imager. The bands were quantified by densitometric analysis using Genetools syngene software. Data are presented as fold change relative to the control.
Quantitative reverse transcription, and PCR (RT-PCR)
Total RNA was isolated from H295R cells, using High Pure RNA Isolation kit (Roche) according to the protocol schedule. Total RNA (500 ng) was reverse transcribed with M-MLV Reverse Transcriptase (Invitrogen) using oligo dT primer (Invitrogen), following the manufacturer’s instructions.
The cDNAs generated were further amplified by real- time PCR using LightCycler 480 SYBR Green I Master kit (Roche). The primers used to amplify the specific segments of respective cDNAs are listed in Table 1.
| hß-actin-F | CCAACCGCGAGAAGATGA |
| hß-actin-R | CCAGAGGCGTACAGGGATAG |
| hSR-BI-F | AGCTTTGGCCTTGGTCTACCT |
| hSR-BI-R | TCTTGTGCTCACTCCATTGTTTTC |
PCR included initial denaturation for 10 min at 95℃, followed by amplification for 55 cycles with denaturation at 95℃ for 10 s, annealing at 56℃ for 10 s, and extension at 72℃ for 30 min. Melting curves were utilized to analyze the PCR products. Differences in gene expression, expressed as fold of change, were calculated using the 2-AAct method where human ß-actin was used as house- keeping gene.
Proliferation assay
The effect of different treatments on proliferation of cells was determined by using Cell Titer-96 Aqueous One Solution Cell Proliferation Assay (Promega). In brief, 20,000 cells per well were seeded in a 96-well plate, and specific treatment was given following 24 h culture with SFM and AngII. Subsequently, the cells were subjected to the assay reagent for 3.5 h at 37℃ in the incubator. The change in color of the media, following reduction of tet- razolium compound to formazan product, was measured by a plate reader at 490 nm. Absorbance was directly pro- portional to the number of viable cells. The results are expressed as percentage of control.
Aldosterone determination
Aldosterone levels in cell culture medium were measured in duplicate by radioimmuno assay (RIA) using Diagnostic Systems Laboratories kit according to the manufacturer’s instruction.
Statistical analysis
All data are presented as mean ± standard error of mean (SEM). Statistical analysis between two groups was carried out by Student’s t test. Multiple comparisons with respect to biochemical characterization of native and modified HDL were performed by one-way analysis of variance (ANOVA) using Statistical Package for Social Sciences (SPSS) followed by post hoc Dunnet’s T3 test. Differences with p values less than 0.05 were considered to be statis- tically significant.
Results
Biochemical characterization of native and modified HDL
Physicochemical characterization of native and modified lipoprotein preparations is summarized in Table 2. While protein carbonyls are formed by a variety of oxidative mechanisms and y-glutamyl semialdehyde appears to be the major residue [28], the fluorescence increase at 365/430 nm is mainly due to modifications of the apolipoprotein lysine residues [27]. The major proteins associated with HDL are apolipoprotein AI (70%) and apolipoprotein AII (20%). Hypochlorite-induced oxidation of the HDL protein com- ponents was characterized by a 2.6-fold increase in the for- mation of fluorescence products at 365/430 nm and by a pronounced 12-fold elevation of protein carbonyl levels. In addition to protein modification, HDL oxidation was fol- lowed by substantial lipid oxidation as reflected by the sig- nificant accumulation of TBARS levels (Table 2).
In previous studies, it has been shown that supra-physio- logical glucose concentrations together with incubation periods in excess of the half-life of lipoproteins are necessary to mimic in vivo glycoxidation [31, 32]. Various mecha- nisms have been proposed to explain this apparent discrep- ancy, e.g., involvement of active glucose metabolites (e.g., glyoxal, methylglyoxal, and glucose-6-phosphate) in in vivo glycoxidation or entrapment of circulating lipoproteins in tissues with following modification and subsequent re-entry into the circulation. However, this phenomenon remains yet largely unexplained [33]. In the present study, exposure of lipoproteins to high glucose levels for 6 days was accom- panied by lower, non-significant increases in protein-
fluorescent products and protein carbonyls. However, the highly specific protein glycoxidation marker CML increased significantly in glycoxidized HDL. Moreover, HDL TBARS levels were significantly elevated after glucose modification (Table 2). To compare the biochemical HDL modifications in the present study with in vivo glycoxidation conditions, we additionally measured HDL lipid modification (TBARS) and protein modification (CML) in subjects with normal glucose tolerance (HDL-NGT) and impaired glucose toler- ance (HDL-IGT). The results presented in Table 2 show that the extents of both HDL lipid and protein modifications are similar during in vitro and in vivo conditions.
Modification of HDL promotes substantial increase in aldosterone release from AngII-sensitized H295R cells
AngII is a powerful vasoconstricting hormone and growth factor with specific negative effects on insulin sensitivity [10]. In order to investigate the influence of AngII on HDL- mediated aldosterone release, H295R cells were pre-incu- bated with AngII (100 nmol/l) for 24 h. The supernatant was discarded, and these cells were subsequently incubated with different forms of HDL or vehicle (PBS) (100 µg/ml) for further 24 h. In order to compare the lipoprotein-mediated effects on AngII-sensitized and -nonsensitized cells, simul- taneously H295R cells were also treated with HDLs for 24 h in the absence of AngII. Then, the supernatant was collected for aldosterone estimation by RIA (Fig. 1). All the forms of HDL evoked a significant increase in steroid release com- pared with its respective control. However, following sen- sitization glycoxHDL induced a twofold increase in steroidogenesis over natHDL.
| Protein modification | Lipid modification TBARS (umol/g) | |||
|---|---|---|---|---|
| RF % (365/430 nm) | PC (umol/g) | CML (ng/mg) | ||
| In vitro modification | ||||
| natHDL | 4.7 ± 0.3 | 7.5 ± 1.4 | 428 ± 39 | 0.5 ± 0.2 |
| oxHDL | 12.4 ± 0.7 *** | 89.7 ± 6.1 *** | 618 ± 131NS | 2.9 ± 0.1 *** |
| glycoxHDL | 5.2 ± 0.5NS | 13.2 ± 2.5NS | 792 ± 104* | 0.9 ±0.1* |
| In vivo modification | ||||
| NGT-HDL | 537 ± 77 | 0.68 ± 0.03 | ||
| IGT-HDL | 620 ± 67 NS | 0.94 ± 0.03 *** | ||
In vitro modification: Data are means ± SEM of 5 (CML) to 15 (RF, PC, and TBARS) lipoprotein preparations, In vivo modification: Data are means ± SEM of 25 (TBARS) and 12 (CML) HDL preparations isolated from subjects with normal glucose tolerance (NGT-HDL) or impaired glucose tolerance (IGT-HDL)
RF relative fluorescence, PC protein carbonyl content, CML Nº-(carboxymethyl)lysine, TBARS thiobarbituric acid-reactive substances, NS not significant
* p < 0.05, *** p < 0.001 as compared with natHDL or NGT-HDL (univariate ANOVA with post hoc Dunnet-T3 test)
Aldosterone (pmol/l)
800
§
700
without Angll
600
with Angll
**
500
**
400
300
200
T
100
0
C
natHDL
glycoxHDL
oxHDL
Inhibition of lipid transfer via SR-BI receptor evokes significant reduction of HDL-mediated aldosterone release
In order to evaluate the impact of SR-BI in selective uptake of lipids, namely, cholesteryl esters, from native and modi- fied HDL, the H295R cells were treated with 100 µg/ml of HDL in the presence or the absence of highly specific SR-BI blocker BLT-1 (block lipid transport-1, 8 umol/l) [34, 35] in SFM for 24 h, and the supernatant was subsequently col- lected for aldosterone estimation. Figure 2 shows a signifi- cant BLT-1-mediated reduction in aldosterone release, induced by all forms of HDL. While with natHDL BLT-1 caused a 53% reduction of aldosterone release, with glycoxHDL and oxHDL, a 37 and 33% reduction, respec- tively, was observed. This indicates that glycoxHDL and oxHDL are equally efficient for transporting the cholesteryl ester through SR-BI into adrenal glands.
GlycoxHDL and oxHDL induce both mRNA and protein expression of SR-BI in H295R cells
In order to investigate the effects of glycoxHDL and oxHDL in SR-BI gene expression, AngII-sensitized H295R cells were treated with 100 µg/ml of native and modified HDL in SFM for 24 h. Subsequently, these cells were used for RNA isolation, followed by quantitative real-time PCR for SR-BI mRNA expression, as well as for Western blotting. As shown in Fig. 3a, natHDL caused a mild 1.6- fold increase in SR-BI mRNA compared with the control (with AngII), whereas glycoxHDL and oxHDL induced
Aldosterone (pmol/l)
120
100
without BLT-1
T
T
T
80
with BLT-1
*
**
60
*
40
20
T
0
C
natHDL
glycoxHDL
oxHDL
significant 2.3- and 2.2-fold increases, respectively. This explains the increased amount of aldosterone release by both the modified forms of HDL.
The Western blot analysis (Fig. 3b) reveals the band corresponding to SR-BI protein at a molecular weight of 82 kDa. The corresponding densitometric values are plot- ted in Fig. 3c. The results show a dose-dependent increase in SR-BI protein expression in H295R cells following incubation with glycoxHDL and oxHDL. As compared to the controls (with AngII), natHDL (100 µg/ml) caused around 40% more stimulation, whereas the glycoxHDL (100 g/ml) and oxHDL (100 µg/ml) caused more than 140 and 110% increase, respectively. This indicates that this protein expression is correlated with the mRNA level induced by native as well as modified HDLs.
Native as well as modified HDL mediate adrenocortical aldosterone release through activation of ERK1/2
It has been demonstrated that three major subfamilies of structurally related mitogen-activated protein (MAP) kinases (ERK1/2, JNK, and p38 MAP kinase) contribute to the transmission of extracellular signal leading to different gene expressions [36]. In order to investigate the involve- ment of these kinases on aldosterone release, the H295R cells were incubated with HDL (100 µg/ml) for 24 h with or without U0126 (10 umol/l), an MEK inhibitor and SB203580 (10 µmol/l), a p38 MAP kinase inhibitor. As shown in Fig. 4a, U0126 produced significant reductions of approximately 32, 34, and 18% of aldosterone release by natHDL, glycoxHDL, and oxHDL, respectively. However, U0126 could not cause complete inhibition, indicating that MAP kinase pathway is not the sole pathway for regulation of aldosterone release from adrenal cells. In contrast,
(a)
3
SR-BI mRNA level (fold of control)
2.5
2
1.5
1
0.5
0
C-(AnglI)
natHDL
glycoxHDL
oxHDL
(b)
natHDL
SR-BI
glycoxHDL
SR-BI
oxHDL
SR-BI
Ang
1µg
10µg
100µg
(c)
ß-actin
Densitometric values (% of control)
300
250
Q 1 µg/ml (3 10 µg/ml = 100 µg/ml
**
200
:
T
150
100
50
0
C- (AnglI)
natHDL
glycoxHDL
oxHDL
SB203580 could not reduce HDL-mediated aldosterone release in H295R cells (data not shown).
HDL requires protein kinase C (PKC) for adrenocortical aldosterone release and recruits ERK1/2 as a downstream effector of PKC
The activation of MAP kinases (p38 and ERK) is monitored by several upstream kinase regulators, such as PKC [37, 38] and phosphatidyl inositol-3 kinase (PI-3 kinase, [39]), either independently or in combination of two or more, in both cell- specific and stimulator-specific manner. To evaluate their
(a)
Aldosterone (pmol/l)
500
without U0126
400
T
with U0126
300
T
200
**
100
0
C
Angli
natHDL
glycoxHDL
oxHDL
(b)
Aldosterone (pmol/l)
500
400
without BIM
300
with BIM
T
200
T
T
*
**
*
T
100
0
C
Angli
natHDL
glycoxHDL
oxHDL
(c)
pERK
ß-actin
natHDL
+
+
-
-
+
+
-
glycoxHDL
-
-
+
+
-
-
+
U0126
-
+
-
+
-
-
-
BIM
-
-
-
-
-
+
+
involvement in aldosterone release, the H295R cells were treated with lipoprotein in the presence or the absence of pharmacological PKC inhibitor bisindolylmaleimide I (2 umol/l), or PI-3-kinase inhibitor LY294002 (10 µmol/l). Figure 4b demonstrates that bisindolylmaleimide I produced a significant inhibitory effect on both modified forms and the native HDL-mediated steroidogenesis. On the contrary, PI-3 kinase inhibitor did not significantly affect any form of HDL- mediated aldosterone release (Data not shown).
To investigate whether HDL-mediated activation of ERK1/2 occurs independently or through PKC, cells were incubated with different forms of HDL (100 µg/ml) in the presence and the absence of U0126 (10 mol/l) and
bisindolylmaleimide (2 umol/l) for 5 min, and whole-cell lysates were utilized for immunoblotting to probe against pERK. The western blot analysis (Fig. 4c) demonstrates that U0126 induced complete inhibition, while bisindolyl- maleimide produced only a partial inhibition of both native and modified forms of HDL-mediated ERK phosphoryla- tion. This indicates that PKC acts as an upstream regulator of ERK activation but not the sole one.
Native and modified HDL exhibit aldosterone release in H295R cells through Janus kinase (Jak)-2-dependent pathway
The results of the present study with MEK inhibitor, U0126, reveal that MAP kinase pathway is not the only important pathway for regulation of aldosterone release from adrenocortical cells. To investigate other independent signaling pathways, such as Jak-STAT [40], the H295R cells were treated with or without specific pharmacological Jak-2 inhibitor AG490 (50 umol/l, [41]) together with native and modified HDL for 24 h, followed by estimation of aldosterone release from the supernatant. The results in Fig. 5a show that Jak-2-mediated hormone release was significantly impeded by AG490 in all the modified forms of HDL with greater significance in case of oxHDL.
In order to analyze the activation of the downstream effector of Jak-2, H295R cells were treated with native and modified HDL (100 µg/ml) for various time periods, and cell extracts were isolated for Western blotting and incubated with phosphospecific STAT-3 antibody. Native as well as modified forms of HDL could stimulate tyrosine phosphor- ylation of STAT3 in a time-dependent manner (Fig. 5b).
GlycoxHDL can significantly induce proliferation of AngII-sensitized H295R cells
In order to evaluate the effect of modification of HDL on proliferation of adrenal zona glomerulosa (ZG) cells, the 24-h serum-starved and AngII-sensitized H295R cells were treated with 100 µg of native and modified HDL for further 24 h. Figure 6 shows that in AngII-sensitized cells, glycox- HDL induced a significant increase in cell number by 67% as compared to 48% in case of natHDL, while in the absence of AngII, this increase was only 30 versus 27% compared to its respective control. However, oxHDL did not influence the proliferation significantly (data not shown).
Discussion
Type 2 diabetes mellitus is a complicated disease, influ- enced by several factors. AngII and aldosterone, active
(a)
Aldosterone (pmol/l)
300
250
☐ without AG490
200
with AG490
150
T
₸
100
**
T
** T
50
T
T
0
C
Angli
natHDL
glycoxHDL
oxHDL
(b)
pSTAT3tyr
ß-actin
C
5min
15min
30min
60min
natHDL
-
+
-
+
-
+
-
+
-
glycoxHDL
-
-
+
-
+
-
+
-
+
Absorbance at 490 nm (% of control)
200
180
☐ without Angll
**
160
with Angll
*
140
T
#
120
100
80
60
40
20
0
C
natHDL
glycoxHDL
components of the RAAS, are primarily involved in cardiovascular homeostasis [42]. Both have also been implicated in the development of pathophysiological con- sequences in T2D. Several clinical and experimental studies have revealed an active association of increased production of AngII and the onset of T2D in human as well as in animal models [43]. In addition to the primary secretagogues, lipoproteins and other paracrine and endo- crine factors also contribute to the differential regulation of aldosterone release from zona glomerulosa cells [44]. The modulatory role of lipoprotein in the precipitation of T2D has been established in rodent beta cells [45]. Moreover, a recent study demonstrated the role of oxidative modifica- tion of LDL in aldosterone release from adrenocortical cells [16]. In the present investigation, attention has been focused on the effects of oxidative and glycoxidative modification of HDL in adrenocortical aldosterone release from AngII-sensitized H295R cells and the underlying possible intracellular mechanism. This study demonstrates that glycoxidative modification of HDL does not attenuate its adrenocortical steroidogenesis potential compared to its native counterpart in contrast to in vivo modified glycox- idized LDL, which shows significant impairment of steroid hormone release from adrenocortical cells [17].
The present study reveals that glycoxHDL is able to induce 2-fold and 3-fold more aldosterone release from the AngII-sensitized cells compared to sensitized natHDL- treated and nonsensitized glycoxHDL-treated H295R cells, respectively. This might explain the pathophysiological contribution of aldosterone in cardiovascular injury in T2D individuals [8].
For the maintenance of steroidogenesis, lipoprotein- derived cholesterols can enter into the cells either by endo- cytic internalization through LDL receptor for low capacity uptake or by selective cholesterol uptake pathway for bulk delivery of cholesterol ester. SR-BI is one of the important members of this selective cholesterol ester uptake pathway [35]. In this study, up-regulation of mRNA level and protein expression of SR-BI by glycoxHDL indicates the significant contribution of SR-BI for delivery of cholesterol to the adrenocortical cells, leading to increased aldosterone release. Furthermore, the result of this study with increased SR-BI expression demonstrates that glycoxidation and oxi- dation of lipoprotein do not reduce induction of scavenger receptors, which is in agreement with the previous studies, conducted by Klein et al. [46] and Thorne et al. [47]. AngII is known to cause induction of SR-BI expression in H295R cells, resulting in higher lipoprotein binding and specific cholesterol uptake from HDL [48]. Therefore, in AngII- sensitized cells, modified HDL might initiate a feed forward loop, giving rise to enhanced release of aldosterone.
Although both the ERK1/2 [49] and p38 MAP kinases [50] are implicated in steroidogenesis, in the present study,
specific involvement of ERK1/2 in case of HDL-mediated aldosterone release in H295R cells was observed. It also demonstrated that glycoxHDL and oxHDL involved SR-BI receptor for aldosterone biosynthesis in H295R cells for induction of MAP kinase (ERK1/2) through PKC-depen- dent pathway. This contradicts the previous results of Grewal et al. [51], who demonstrated in CHO cells the evidence of PKC-independent pathway for activation of MAP kinases following involvement of SR-BI. This dis- crepancy may be attributed to the difference in cell type and triggering factor. However, in this study observations with U0126 (MEK inhibitor) and AG490 (Jak-2 inhibitor) provide the evidence of a HDL-induced complex signaling cascade involving both the MAP kinase (ERK)- and Janus kinase-2-mediated pathways where oxHDL is more dependent on Jak-2 than ERK1/2 for the differential reg- ulation of adrenocortical steroidogenesis.
Previous studies have revealed that AngII mediates its intracellular effects through PKC-MAP kinase [38] and Jak-STAT [41] pathways, which are comparable with the present study concerning glycoxHDL- and oxHDL-medi- ated aldosterone release from H295R cells. These obser- vations, related to similar signaling mechanism adopted by AngII as well as modified HDL, give rise to synergistic effect and contribute to augmented aldosterone release from adrenal cortex.
In addition to aldosterone release, AngII can stimulate proliferation of adrenal zona glomerulosa cells through activation of MAP kinase [52]. Therefore, the present study could establish an exciting link between glycoxHDL-medi- ated proliferation of zona glomerulosa cells and enhanced aldosterone release in diabetic patients. This HDL-mediated proliferation of adrenocortical zona glomerulosa cells resulting in pronounced activation of steroid synthesis machinery in hyperglycemic conditions is in agreement with a previous study which showed that HDL improves cell survival by inhibition of apoptosis in human and mouse islet cells [53]. The heterogeneous structure of the HDL particle including lipids, apolipoproteins, enzymes, as well as vari- ous HDL receptors may contribute to the diverse HDL- mediated actions, such as atheroprotection, aldosterone synthesis, prevention of apoptosis, etc.
From the present study, it can be concluded that modi- fication of HDL does not impair, but rather aggravates, the steroidogenic potential leading to increased aldosterone release in AngII-sensitized H295R cells. All indicated forms of HDL depend partially on SR-BI for adrenocortical aldosterone release. Both glycoxHDL and oxHDL recruit MAP kinase and Janus kinase for aldosterone biosynthesis in H295R cells. Native as well as modified forms of HDL utilize ERK1/2 as a downstream effector of PKC. More- over, glycoxHDL can induce significant adrenocortical cellular proliferation explaining the augmented aldosterone
release induced by glycoxidative modification of HDL. HDL in T2D, following glycoxidative modification, no longer possesses complete atheroprotective activities, ren- dering the individual prone to macrovascular disease. At the same time, this modification could potentiate the adrenocortical aldosterone release which is an independent risk factor in diabetic and prediabetic individuals. There- fore, glycoxHDL and oxHDL act as a double edged-sword. It also demands further detailed in vivo investigation to determine its physiological relevance.
Acknowledgment The authors thank Martina Kohl, Sigrid Nitz- sche, and Eva Schubert for their excellent technical support. This work was supported by the Deutsche Forschungsgemeinschaft (KFO 252 to SRB).
Conflict of interest The authors declare that there is no conflict of interest.
References
1. Sviridov D, Nestel P (2002) Dynamics of reverse cholesterol transport: protection against atherosclerosis. Atherosclerosis 161(2):245-254
2. Gotto AM, Brinton EA Jr (2004) Assessing low levels of high- density lipoprotein cholesterol as a risk factor in coronary heart disease. J Am Coll Cardiol 43:717-724
3. Kontush A, Chapman JM (2006) Functionally defective HDL: a new therapeutic target at the crossroads of dyslipidemia, inflammation and atherosclerosis. Pharmacol Rev 58:342-374
4. Azhar S, Leers-Sucheta S, Reaven E (2003) Cholesterol uptake in adrenal and gonadal tissues: the SR-BI and ‘selective’ pathway connection. Front Biosci 8:s998-s1029
5. Hu J, Zhang Z, Shen WJ, Azhar S (2010) Cellular cholesterol delivery, intracellular processing and utilization for biosynthesis of steroid hormones. Nutr Metab 7(47):1-25
6. Cherradi N, Bideau M, Arnaudeau S, Demaurex N, James RW, Azhar S et al (2001) Angiotensin II promotes selective uptake of high density lipoprotein cholesterol esters in bovine adrenal glomerulosa and human adrenocortical carcinoma cells through induction of scavenger receptor class B type I. Endocrinology 142:4540-4549
7. Krug AW, Kopprasch S, Ziegler CG, Dippong S, Catar RA, Bornstein SR et al (2007) Aldosterone rapidly induces leukocyte adhesion to endothelial cells: a new link between aldosterone and arteriosclerosis? Hypertension 50:e156-e157
8. Krug AW, Ehrhart-Bornstein M (2008) Aldosterone and meta- bolic syndrome: is increased aldosterone in metabolic syndrome patients an additional risk factor? Hypertension 51:1252-1258
9. Fujita T (2008) Aldosterone in salt sensitive hypertension and metabolic syndrome. J Mol Med 86:729-734
10. Henriksen EJ (2007) Improvement of insulin sensitivity by antagonism of the renin-angiotensin system. Am J Physiol Regul Integr Comp Physiol 293:R974-R980
11. Nathan DM, Cleary PA, Backlund JY, Genuth SM, Lachin JM, Orchard TJ et al (2005) Intensive diabetes treatment and car- diovascular disease in patients with type I diabetes. N Engl J Med 353:2643-2653
12. Graessler J, Pietzsch J, Westendorf T, Julius U, Bornstein SR, Kopprasch S (2007) Glycoxidised LDL isolated from subjects
with impaired glucose tolerance increases CD36 and peroxisome proliferator-activator receptor y gene expression in macrophages. Diabetologia 50:1080-1088
13. Veiraiah A (2005) Hyperglycemia, lipoprotein glycation, and vascular disease. Angiology 56:431-438
14. Toshima S, Hasegawa A, Kurabayashi M, Itabe H, Takano T, Sugano J et al (2000) Circulating oxidized low density lipoprotein levels: a biochemical risk marker for coronary heart disease. Arterioscler Thromb Vasc Biol 20:2243-2247
15. Kopprasch S, Pietzsch J, Kuhlisch E, Fuecker K, Temelkova- Kurktchiev T, Hanefeld M et al (2002) In vivo evidence of increased oxidation of circulating LDL in impaired glucose tol- erance. Diabetes 51:3102-3106
16. Ansurudeen I, Pietzsch J, Graessler J, Ehrhart-Bornstein M, Saha S, Bornstein SR et al (2010) Modulation of adrenal aldosterone release by oxidative modification of low-density lipoprotein. Am J Hypertens 23(10):1061-1068
17. Kopprasch S, Pietzsch J, Ansurudeen I, Graessler J, Krug AW, Ehrhart-Bornstein M et al (2009) Prediabetic and diabetic in vivo modification of circulating low density lipoprotein attenuates its stimulatory effect on adrenal aldosterone and cortisol secretion. J Endocrinol 200:45-52
18. Hoang A, Murphy AJ, Coughlan MT, Thomas MC, Forbes JM, O’Brien R et al (2007) Advanced glycation of apolipoprotein A-I impairs its anti-atherogenic properties. Diabetologia 50(8): 1770-1779
19. Nobecourt E, Davies MJ, Brown BE, Curtiss LK, Bonnet DJ, Charlton F et al (2007) The impact of glycation on apolipoprotein A-I structure and its ability to activate lecithin: cholesterol acyltransferase. Diabetologia 50(3):643-653
20. Mastorikou M, Mackness B, Liu Y, Mackness M (2008) Glyca- tion of paraoxonase-1 inhibits its activity and impairs the ability of high density lipoprotein to metabolize membrane lipid hydroperoxides. Diabet Med 25:1049-1055
21. Goodfriend TL, Egan B, Stepniakowski K, Ball DL (1995) Relationships among plasma aldosterone, high-density lipopro- tein cholesterol, and insulin in humans. Hypertension 25:30-36
22. Bochud M, Nussberger J, Bovet P, Maillard MR, Elston RC, Pac- caud F et al (2006) Plasma aldosterone is independently associated with the metabolic syndrome. Hypertension 48:239-245
23. Fallo F, Veglio F, Bertello C, Sonino N, Della MP, Ermani M et al (2006) Prevalence and characteristics of the metabolic syndrome in primary aldosteronism. J Clin Endocrinol Metab 91:454-459
24. Kathiresan S, Larson MG, Benjamin EJ, Corey D, Murabito JM, Fox CS et al (2005) Clinical and genetic correlates of serum aldosterone in the community: the Framingham heart study. Am J Hypertens 18:657-665
25. Xing Y, Cohen A, Rothblat G, Sankaranarayanan S, Weibel G, Royer L et al (2011) Aldosterone production in human adreno- cortical cells is stimulated by high-density lipoprotein 2 (HDL2) through increased expression of aldosterone synthase (CYP11B2). Endocrinology 152:751-763
26. Pietzsch J, Subat S, Nitzsche S, Leonhardt W, Schentke KU, Hanefeld M (1995) Very fast ultracentrifugation of serum lipo- proteins: influence on lipoprotein separation and composition. Biochim Biophys Acta 1254:77-88
27. Maeba R, Shimasaki H, Ueta N (1994) Conformational changes in oxidized LDL recognized by mouse peritoneal macrophages. Biochim Biophys Acta 1215:79-86
28. Levine RL, Garland D, Oliver CN, Amici A, Climent I, Lenz AG et al (1990) Determination of carbonyl content in oxidatively modified proteins. Methods Enzymol 186:464-478
29. Yagi K (1976) A simple fluorometric assay for lipoperoxide in blood plasma. Biochem Med 15:212-216
30. Laemmly UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685
31. Younis N, Charlton-Menys V, Sharma R, Soran H, Durrington PN (2009) Glycation of LDL in non-diabetic people: small dense LDL is preferentially glycated both in vivo and in vitro. Ath- erosclerosis 202:162-168
32. Braschi S, Geoffrion M, Nguyen A, Gaudreau Y, Milne RW (2006) The expression of apolipoprotein B epitopes is normal in LDL of diabetic and end-stage renal disease patients. Diabeto- logia 49:1394-1401
33. Younis N, Sharma R, Soran H, Charlton-Menys V, Elseweidy M, Durrington PN (2008) Glycation as an atherogenic modification of LDL. Curr Opin Lipidol 19(4):378-384
34. Nieland TJF, Chroni A, Fitzgerald ML, Maliga Z, Zannis VI, Kirchhausen T et al (2004) Cross-inhibition of SR-BI- and ABCA1-mediated cholesterol transport by the small molecules BLT-4 and glyburide. J Lipid Res 45:1256-1265
35. Osada Y, Shiratsuchi A, Nakanishi Y (2006) Involvement of mitogen activated protein kinases in class B scavenger receptor I-induced phagocytosis of apoptotic cells. Exp Cell Res 312(10): 1820-1830
36. Marshall CJ (1994) MAP kinase kinase kinase, MAP kinase kinase and MAP kinase. Curr Opin Genet Dev 4(1):82-89
37. Mendez AJ, Oram JF, Bierman EL (1991) Protein kinase C as a mediator of high density lipoprotein receptor-dependent efflux of intracellular cholesterol. J Biol Chem 266(16):10104-10111
38. Tian Y, Smith RD, Balla T, Catt KJ (1998) Angiotensin II acti- vates mitogen-activated protein kinase via protein kinase C and Ras/Raf-1 kinase in bovine adrenal glomerulosa cells. Endocri- nology 139(4):1801-1809
39. Nofer JR, Fobker M, Höbbel G, Voss R, Wolinska I, Tepel M et al (2000) Activation of phosphatidylinositol-specific phos- pholipase C by HDL-associated lysosphingolipid: involvement in mitogenesis but not in cholesterol efflux. Biochemistry 39: 15199-151207
40. Darnell JE Jr (1997) STATs and gene regulation. Science 277:1630-1635
41. Li J, Feltzer RE, Dawson KL, Hudson EA, Clark BJ (2003) Janus kinase 2 and calcium are required for angiotensin II-dependent activation of steroidogenic acute regulatory protein transcription in H295R human adrenocortical cells. J Biol Chem 278(52): 52355-52362
42. Leung PS, Carlsson PO (2001) Tissue renin-angiotensin system: its expression, localization, regulation and potential role in the pancreas. J Mol Endocrinol 26(3):155-164
43. Chu YK, Leung PS (2009) Angiotensin II in type 2 diabetes mellitus. Curr Protein Pept Sci 10:75-84
44. Willenberg HS, Schinner S, Ansurudeen I (2008) New mecha- nisms to control aldosterone synthesis. Horm Metab Res 40: 435-441
45. Brunham LR, Kruit JK, Verchere CB, Hayden MR (2008) Cho- lesterol in islet dysfunction and type 2 diabetes. J Clin Invest 118: 403-408
46. Klein RL, Laimins M, Lopes-Virella MF (1995) Isolation, char- acterization, and metabolism of the glycated and nonglycated subfractions of low-density lipoproteins isolated from type I diabetic patients and nondiabetic subjects. Diabetes 44(9): 1093-1098
47. Thorne RF, Mhaidat NM, Ralston KJ, Burns GF (2007) CD36 is a receptor for oxidized high density lipoprotein: implications for the development of atherosclerosis. Fed Eur Biochem Soc 581(6): 1227-1232
48. Pilon A, Martin G, Bultel-Brienne S, Junquero D, Delhon A, Fruchart JC et al (2003) Regulation of scavenger receptor BI and the LDL receptor by activators of aldosterone production, angiotensin II and PMA, in the human NCI-H295R adrenocor- tical cell line. Biochemica et Biophysica Acta 1631:218-228
49. Martinat N, Crépieux P, Reiter E, Guillou F (2005) Extracellular signal-regulated kinases (ERK)1, 2 are required for luteinizing hormone (LH)-induced steroidogenesis in primary Leydig cells and control steroidogenic acute regulatory (StAR) expression. Reprod Nutr Dev 45:101-108
50. Ansurudeen I, Willenberg HS, Kopprasch S, Krug AW, Ehrhart- Bornstein M, Bornstein SR (2009) Endothelial factors mediate aldosterone release via PKA-independent pathways. Mol Cell Endocrinol 300(1-2):66-70
51. Grewal T, de Diego I, Kirchhoff MF, Tebar F, Heeren J, Rinn- inger F et al (2003) High density lipoprotein-induced signaling of the MAPK pathway involves scavenger receptor type BI-medi- ated activation of Ras. J Biol Chem 278:16478-16481
52. Foster RH (2004) Reciprocal influences between the signalling pathways regulating proliferation and steroidogenesis in adrenal glomerulosa cells. J Mol Endocrinol 32(3):893-902
53. Rütti S, Ehses JA, Sibler RA, Prazak R, Rohrer L, Georgopoulos S et al (2009) Low- and high-density lipoproteins modulate function, apoptosis, and proliferation of primary human and murine pancreatic ß cells. Endocrinology 150(10):4521-4524