ELSEVIER
Contents lists available at ScienceDirect
Domestic Animal Endocrinology
journal homepage: www.domesticanimalendo.com
DOMESTIC ANIMAL ENDOCRINOLOGY
Short Communication
Gonadectomy-related adrenocortical tumors in ferrets demonstrate increased expression of androgen and estrogen synthesizing enzymes together with high inhibin expression
M.K. de Jong ª, E.E.M. ten Asbroek ª, A.J. Sleiderink ª, A.J. Conley b, J.A. Mola, N.J. Schoemaker ª,*
a Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands b Department of Population Health and Reproduction, School of Veterinary Medicine, University of California at Davis, Davis, CA
ARTICLE INFO
Article history: Received 19 September 2013
Received in revised form 17 January 2014 Accepted 8 February 2014
Keywords:
Ferret Adrenocortical tumor Inhibin Aromatase
ABSTRACT
The 2 objectives of this study were to (1) measure by quantitative polymerase chain re- action the expression of genes involved in steroid and inhibin synthesis in adrenocortical tumors of gonadectomized ferrets and (2) localize by immunohistochemistry several proteins that are key to adrenal steroidogenesis. Relative to the control adrenals, expres- sion of the messenger RNAs encoding StAR (steroidogenic acute regulatory protein; P = 0.039), CYP11A (P = 0.019), CYP21 (P = 0.01), and 36-HSD (P = 0.004), all involved in the synthesis of mineralocorticoids and glucocorticoids, were decreased in the adreno- cortical tumors. In contrast, expression of cytochrome B5 (CytB5; P = 0.0001) and aro- matase (P = 0.003), involved in androgen and estrogen synthesis, and both inhibin a .- subunit (P = 0.002) and BB-subunit (P = 0.001) were upregulated. In tumors, immu- nostaining of CYP21 was low, whereas staining of Cyp17 and CytB5, necessary for androgen synthesis, was present. It is concluded that ferret adrenocortical tumors express genes for androgen production. In addition, the expression of aromatase and inhibin suggests an even more gonadal differentiation, which is reminiscent to the fact that both gonads and adrenals are derived from a common urogenital primordial cell.
@ 2014 Elsevier Inc. All rights reserved.
1. Introduction
In neutered ferrets, adrenocortical tumors are very common [1] and are known for their excessive sex steroid production [2]. It is generally believed that the increased secretion of gonadotropins, predominantly luteinizing hormone, which occurs after castration causes adrenocor- tical hyperplasia and ultimately tumorigenesis. This hy- pothesis is supported by the evidence of luteinizing hormone receptor (LHR) expression in the adrenal glands of ferrets and a positive response to the gonadotropin releasing hormone (GnRH) stimulation test in neutered ferrets with an adrenocortical tumor [3].
It has been hypothesized that in response to stimulation by increased gonadotropins, undifferentiated gonadal cells in the adrenal gland could differentiate to cells with gonadal characteristics [2]. These steroidogenic cells in the adrenal cortex are thought to stem from a pool of meso- dermal progenitors in the urogenital ridge from which the gonads and kidneys are derived as well. During embryo- genesis, the urogenital ridge cells associate with neural crest cells to form an adrenal gland [4]. This proposed hy- pothesis is supported by the finding of many gonadal characteristics in gonadectomy-induced adrenocortical tumors in certain inbred strains of mice which are thought to share the same pathophysiology as ferrets [5].
In murine adrenocortical tumors, cells with gonadal characteristics demonstrate themselves in a variety of ways. Steroidogenic enzymes more consistent with a gonadal than adrenal phenotype, CYP17, and aromatase
* Corresponding author. Tel .: +31 302531384; fax: +31 302518126. E-mail address: N.J.Schoemaker@uu.nl (N.J. Schoemaker).
have been found in adrenocortical tumors in mice [6]. The enzyme CYP17 possesses a dual action and its 17,20-lyase activity is essential for androgen synthesis. The enzyme is normally expressed in the fetal and postnatal adrenal of human and other higher primates [7] but is not present in the adrenal of postnatal mice. The recurrence of CYP17 expression in adrenocortical tumor cells in susceptible mouse strains suggests gonadal cell differentiation [5].
Another gonadal steroidogenic cell marker expressed in the adrenocortical tumor cells of mice of susceptible strains is the LHR [5]. The functional LHR is thought to serve as a promoter when expressed in the adrenal gland and is stimulated by luteinizing hormone. Inhibin, a member of the transforming growth factor beta family, is another gonadal marker known to be expressed in adrenocortical tumors in mice. Inhibin is a covalently linked heterodimer formed by an inhibin a-subunit with 1 of the 2 B-subunits. The expression of the inhibin a-subunit is limited to ste- roidogenic tissues, such as the gonads and adrenal cortex, where it regulates growth and differentiation [8]. In inhibin-a knockout mice, there is a high incidence of adrenocortical tumor development after gonadectomy, and inhibin-o. expression is increased in adrenocortical tumor cells of certain strains of mice [5].
Some work has been done investigating the develop- ment of gonadal cell phenotype in ferret adrenocortical tumors as well. The normal ferret adrenal glands produce the adrenal androgens dehydroepiandrosterone, its sulfate (dehydroepiandrosterone-S), and androstenedione in small amounts [2]. Adrenocortical tumors produce excessive amounts of sex steroids, but so far only cytochrome B5 (CytB5) has been investigated. Cytochrome B5 plays a pivotal role in the positive regulation of androgen pro- duction, by stimulating the 17,20-lyase reaction of CYP17 [9]. Wagner et al [10] have shown the presence of CytB5 in most sex steroid-producing adrenocortical tumors in contrast to the absence in normal adrenocortical cells. The expression of LHR is another gonadal characteristic that has been demonstrated on the adrenal cortex of the ferret [3]. Inhibin has been mentioned as a possible key player in the adrenocortical tumorigenesis in ferrets [11] and ferret adrenocortical tumors with myxoid differentiation are known to stain for inhibin-o. [12].
To further characterize the gonadal characteristics of the steroid-producing adrenocortical tumor cells, the expression of the messenger RNA (mRNA) encoding the cholesterol transporting protein StAR, several steroidogenic enzymes (CYP11A, CYP17, CytB5, 3ß-HSD, CYP21, and aromatase), and inhibin subunits were investigated by quantitative poly- merase chain reaction (qPCR). In addition, the local expres- sions of various investigated proteins were studied.
2. Materials and methods
2.1. Animals and tissues
The group of normal ferret adrenal glands for the qPCR study consisted of 10 left adrenal glands from healthy male ferrets, all which were euthanized for reasons unrelated to this study. They originated from institutionally approved studies conducted at the Animal Sciences Group, Wage- ningen University and Research Centre, ID-Lelystad and the Department of Clinical Sciences of Companion Animals of Utrecht University.
The tumor group consists of 9 archival specimens ob- tained from patients during adrenalectomy at the Depart- ment of Clinical Sciences of Companion Animals of Utrecht University. The following selection criteria were used: the ferrets (1) had to be surgically neutered and should not have received an implant containing a depot-GnRH agonist; (2) had to exhibit one or more signs of hyper- adrenocorticism (Table 1); and (3) excised adrenal glands were classified histopathologically into adenomas or car- cinomas. For some animals, the results from a GnRH stimulation test [13] were available (Table 1). After collec- tion, all tissues were frozen in liquid nitrogen and held at -70℃ until RNA extraction.
For immunohistochemistry, adrenal glands of 5-yr-old, surgically castrated male ferrets (n = 5) from an unrelated study, approved by the Ethics Committee of the Faculty of Veterinary Medicine, Utrecht University, were used. After a human chorionic gonadotropin stimulation test [13], the ferrets were euthanized and the left adrenal glands were collected and fixed in paraformaldehyde and classified (Table 2).
| Number | Sex | Age (yr) | Adrenal pathology | Androstenedione (nmol/L) | Clinical signs | ||||
|---|---|---|---|---|---|---|---|---|---|
| T= 0 | T=30 | Symmetrical alopecia | Pruritus | Vulvar swelling | Return of sexual behavior | ||||
| 1 | M | 8 | LA | NT | NT | + | + | ||
| 2 | M | 3 | LA | NT | NT | + | + | ||
| 3 | F | 3 | LC | NT | NT | + | + | ||
| 4 | M | 4 | LA | NT | NT | + | + | ||
| 5 | M | 6 | LA | NT | NT | + | + | + | |
| 6 | F | 5 | LA | NT | NT | + | + | ||
| 7 | M | 5 | RC | 0.60 | NT | + | + | ||
| 8 | M | 6 | RA | 1.5 | NT | + | + | ||
| 9 | M | 3 | LC | 0.30 | 2.6 | + | |||
Abbreviations: A, adenoma; Age, age at removal adrenal tumor in years; C, carcinoma; F, female; L, left adrenal gland; M, male; NT, not tested; R, right adrenal gland; T = 0, androstenedione measurement without stimulation; T = 30, androstenedione measurement 30 min after GnRH administration.
| Number | Group | Adrenal pathology | DHEA (nmol/L) | DHEAS (umol/L) | Androstenedione (nmol/L) | |||
|---|---|---|---|---|---|---|---|---|
| T= 0 | T=60 | T= 0 | T =60 | T= 0 | T=60 | |||
| 2 | S | LH | <1.0 | <1.0 | <0.10 | <0.10 | <0.5 | <0.5 |
| 5 | S | LH | <1.0 | <1.0 | <0.10 | <0.10 | <0.5 | 0.7 |
| 11 | S | LH | <1.0 | <1.0 | <0.10 | <0.10 | <0.5 | <0.5 |
| 12 | S | LA | <1.0 | <1.0 | <0.10 | <0.10 | 0.6 | 1.4 |
| 13 | S | LA | <1.0 | 1.2 | <0.10 | <0.10 | 0.5 | 2.3 |
Abbreviations: A, adenoma; DHEA, dehydroepiandrosterone; DHEAS, dehydroepiandrosterone sulfate; H, hyperplasia; L, left adrenal gland; S, surgically castrated; T = 0, measurement without stimulation; T = 60 measurement 60 min after human chorionic gonadotropin (hCG) administration.
2.2. Quantitative real-time polymerase chain reaction
The RNAeasy MiniKit with an additional on column DNAse digestion step was used to extract RNA from tissues (Qiagen, Leusden, The Netherlands). The RNA concentra- tions were measured using the Isogen Nanodrop ND-1000 (Isogen Life Sciences BV, Ijsselstein, The Netherlands) and complementary DNA was synthesized with the iScriptTM cDNA Synthesis Kit (Bio-Rad, Veenendaal, The Netherlands). A reverse transcriptase negative (RT-) product was used from each sample as a control.
Primers were designed using homologous regions within canine and other mammal DNA sequences as the ferret genome was yet unknown at the start of the exper- iments. Software for primer design was PrimerSelect soft- ware (Lasergene DNAstar 8.1) or Perlprimer (v.1.1.14 http:// perlprimer.sourceforg.net). The qPCR conditions were opti- mized by performing reactions under gradually increasing annealing temperatures. The specificity of the primers was tested by melt curve analysis and product sequencing with the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). The ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) was used for sequence analysis.
Quantitative PCRs were performed using a My-iQ Single Color Real-Time PCR Detection System and SYBRGreen Supermix (Bio-Rad, Hercules, CA), using the designed primers and optimal annealing temperatures (Table 3). Each reaction was performed in duplicate, ran along with their RT- products and a no-template control as a negative con- trol. Each reaction was completed with a melt curve analysis.
For normalization, optimal qPCR reference genes were chosen from 7 commonly used reference genes using geN- orm (http://medgen.ugent.be/~jvdesomp/genorm/). Genes with an M value >1.5 were excluded and V values were chosen to be <0.15 and as low as reasonably possible. Quantitative PCRs data were analyzed using the iQ5 Real- Time PCR Detection System (Bio-Rad).
2.3. Statistical analysis
The software program REST 2008, using a pairwise fixed reallocation randomization test [14], was used to normalize for differences in reference gene expression between samples and for statistical analysis of qPCR data between normal adrenal glands and adrenocortical tumors. The analysis was done separately for the steroidogenic enzymes
data and the inhibin data. Differences were considered to be significant if P < 0.05.
2.4. Immunohistochemistry
Sections were deparaffinized through a graded alcohol series (100%, 95% and 70% ethanol), rinsed in tap water, and endogenous peroxidase activity was quenched with 0.3% H2O2 in methanol. Slides were rinsed in phosphate- buffered saline and blocked by incubating sections for 20 min with 1.5% normal serum of the species in which the secondary antibody was raised. Tissue sections were
| Gene | Primer sequence | Optimal annealing temperature | |
|---|---|---|---|
| HPRT (REF) | U | agcttgctggtgaaaaggac | 56.0℃ |
| L ttatagtcaagggcatatcc | |||
| RPL8 (REF) | U ccatgaatcctgtggagc | 60.9℃ | |
| L gtagagggtttgccgatg | |||
| RPS19 (REF) | U ccttcctcaaaaagtctggg | 62.0°C | |
| L gttctcatcgtagggagcaag | |||
| RPS5 (REF) | U tcactggtgagaaccccct | 57.5℃ | |
| L cctgattcacacggcgtag | |||
| GAPDH (REF) | U | tgtccccacccccaatgtatc | 53.5℃ |
| L ctccgatgcctgcttcactacctt | |||
| CYP17 (TRG) | U cctgcggcccctatgctc | 62.2℃ | |
| L ggccggtaccactccttctca | |||
| CYP11A (TRG) | U caccgcctccttaaaaagtaacaag | 65.2°C | |
| L gctgcgtgccatctcgtag | |||
| StAR (TRG) | U ctctgcttggttctcgg | 57.7℃ | |
| L ccttcttccagccttcc | |||
| 3ß-HSD (TRG) | U | caggagggtttctgggtcag | 58.6°C |
| L aggctctcttcaggcactgc | |||
| CYP21 (TRG) | U agcccgaccttcccctccacctg | 65.7℃ | |
| L tctgccggcgaagtccacccattt | |||
| Aromatase (TRG) | U gagtctggatatgtggagag | 63.6℃ | |
| L gctgtagtgactgtgct | |||
| Cytochrome B5 (TRG) | U | caagccttcggaaactctcattac | 58.6°C |
| L gatacatcagggctaccaccagt | |||
| INHA (TRG) | U aggaggatgtctcccaggc | 67.0℃ | |
| L gtgtggaaccacaggtgggc | |||
| INHBA (TRG) | U tgcacttgaagaagagacccg | 55.0°C | |
| L ggatggtgactttggtcctgg | |||
| INHBB (TRG) | U | agatcccgcacctcgacggc | 68.0℃ |
| L | aagaagtacaggcggacccg | ||
Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HPRT, hypoxanthine phosphoribosyltransferase 1; L, lower primer; REF, reference gene; RPL8, ribosomal protein L8; RPS19, ribosomal protein S19; RPS5, ribosomal protein S5; TRG, target gene; U, upper primer.
incubated overnight at 4℃ with primary antisera against CYP17 (rabbit anti-bovine P450c17, 1:2,500, [7]), CytB5 (rabbit anti-human cytochrome b5, 1:2,500 [15]), and CYP21 (rabbit anti-human P450c21, 1:5,000 [7]). Normal serum was substituted for the primary antibody in negative controls. After incubation with the primary antibody, slides were rinsed for 5 min in phosphate-buffered saline and incubated with a biotinylated secondary antibody for 30 min before detection using the Vectastain ABC detection kit (Vector Laboratories; Burlingame, CA). Antibody bind- ing was visualized using peroxidase substrate kits (Vector NovaRed or 3-amino-9-ethylcarbazole; Vector Labora- tories) and counterstained with hematoxylin.
3. Results
3.1. Reference gene selection
For the experiment concerning the steroidogenic en- zymes and cofactors, RPS5, RPS19, and RPL8 were best suitable as reference genes. For the experiment concerning inhibin expression, HPRT, RPL8, and GAPDH were found to be the most suitable reference genes.
3.2. Quantitative polymerase chain reaction
All 7 investigated steroidogenic enzymes and proteins were detectable by qPCR in both normal and tumor adrenal gland tissue. Compared with normal adrenocortical tissues, adrenocortical tumors showed a significant upregulation of aromatase (21.6-fold, P = 0.003) and CytB5 mRNA (55.7- fold, P = 0). Significant downregulation was evident in the mRNA of CYP11A (4.8-fold, P = 0.019), CYP21 (17.9-fold, P= 0.01), 3ß-HSD (5.6-fold, P = 0.004), and StAR (4.4-fold, P = 0.039). The mRNA of the enzyme CYP17 was not significantly changed. In both normal and tumor adrenal gland tissue mRNA of INHA, INHBA and INHBB mRNA were detectable. Both INHA and INHBB are significantly upre- gulated in adrenocortical tumors (respectively 18.0-fold, P = 0.002 and 14.2-fold, P = 0.001), but INHBA mRNA was not significantly changed.
3.3. Immunohistochemistry
In adrenal glands from healthy control animals, CYP17 and CYP21 staining was positive in both zona fasciculata (ZF) and zona reticularis (ZR), whereas CytB5 staining was most intensely in the zona glomerulosa (ZG) (Fig. 1). One hyperplastic adrenal gland (1/3) and all (2/2) adenomas stained positively for CYP17. The staining of CYP21 was markedly reduced and only weakly present in one hyper- plastic adrenal gland (1/3) and one (1/2) adenoma. Positive staining for CytB5 was seen in one hyperplasia (1/3) and all adenomas (2/2) (Fig. 1).
4. Discussion
The mRNAs encoding all the studied steroidogenic en- zymes, the transport protein StAR, and the inhibin subunits were detectable by qPCR in both normal and neoplastic adrenocortical tissue.
The downregulation of the StAR mRNA does not seem to correspond with the increase in sex steroid synthesis. This transport protein is responsible for the acute response to a steroidogenic stimulus by enhanced transcription, trans- lation, or activity of this enzyme [16]. However, in this situation, an increase in the activity of the cells of the ZF is present, whereas in the ferret, the cells exhibit a more ZR phenotype based on the current data, especially increased CytB5 mRNA. Obviously the expression of StAR mRNA is lower in comparison with the normal adrenal gland of the ferret where also the ZF predominates but still sufficient for the enhanced production of androgens and estrogens. The mRNA of steroidogenic enzyme CYP11A is also significantly downregulated in this study. This enzyme converts cholesterol to pregnenolone, making it essential for all steroids in the synthetic cascade. However, in human adrenocortical tumors, CYP11A mRNA expression is not al- ways increased in steroid-producing tumors [17]. As CYP17 is involved in both glucocorticoid and androgen synthesis, an unchanged expression of the mRNA in adrenocortical tumors is not unexpected. Also the immunohistochemical staining of both ZF and ZR is in line with this dual function and in agreement with the results in primates [15,18].
The downregulation of 3ß-HSD mRNA demonstrated in the ferret adrenocortical tumors was expected as the competition with CYP17 for substrates makes 3ß-HSD favor the production of aldosterone and cortisol. So the down- regulation is in agreement with a sex steroid-producing tumor. The significant downregulation of CYP21 mRNA is also in agreement with the steroid profile secreted because CYP21 is not involved in androgen synthesis, but leads to aldosterone (ZG) and cortisol (ZF) production [7]. Normal ferret adrenal glands expressed CYP21 in their ZG and ZF as expected. The faint to absent staining in adenomas confirmed their commitment toward sex steroid synthesis.
An expected, but remarkably high, upregulation of CytB5 mRNA expression was found in ferret adrenocortical tumors. In humans, high CytB5 mRNA expression is linked to androgen-producing tumors [18]. Based on the zonation of steroid production in primates, we expected to find staining in the normal ZR in agreement with expression of CytB5 mRNA in the adult human and monkey adrenal glands [ 15,18]. However and in contrast with previous findings where no CytB5 expression in normal adrenal glands was found [10], CytB5 staining was also found in the ZG of normal ferret ad- renal glands. If this is due to a higher affinity of the present antibody or cross reactivity awaits further validation.
This study presents the first evidence of the expression of aromatase in ferret adrenal glands. Aromatase catalyzes the aromatization of androgens and is a key enzyme in estrogen biosynthesis. Although the enzyme is mainly localized in the ovary and placenta, it is also found in testis and adrenal glands of some species [19]. Expression of aromatase mRNA is significantly upregulated in adreno- cortical tumors compared with normal adrenals. In human adrenocortical tumors also, a tendency toward upregula- tion of aromatase mRNA expression has been found in feminizing adrenocortical tumors [20]. Adrenocortical tu- mors in ferrets lead to high plasma estrogen concentrations [2], which may not as previously thought be due to pe- ripheral aromatization of adrenal androgens but seem
Normal
Adenoma
CYP17
CYP21
CytB5
indeed a reflection of adrenal estrogen production. Unfor- tunately, due to absent cross reactivity, staining for aro- matase was unsuccessful.
The coexpression of CYP17 and CytB5 and absence of CYP21 in ferret adrenal gland tumors confirm an adrenal gland directed toward sex steroid synthesis. Generally, coexpression of CYP17 and CytB5 in the absence of 3ß-HSD in the same cell is typical of adrenal androgen rather than cortisol synthesis [21]. Although StAR, CYP11A, and CYP17 are not exclusive for adrenal androgen and estrogen syn- thesis, they are necessary for this process. The shift in the balance of steroidogenic enzymes is most likely caused by the replacement of the mineralocorticoid, glucocorticoid, and androgen-producing cells of the normal cortex by primarily androgen- and estrogen-secreting cells. The downregulated proteins may well be present in a sufficient amount to facilitate androgen and estrogen synthesis.
Both INHA and INHBB mRNA were significantly upre- gulated in adrenocortical tumors compared with normal adrenal glands, showing the enhancement of another gonadal marker in the tumors. The transcript of the gene INHA gives rise to the inhibin a-subunit and INHBB to the
inhibin BB-subunit. Together they form inhibin-B. Ferret adrenocortical tumors are known to stain positively for inhibin-a with a diffuse cytoplasmic staining [22]. The findings of upregulated inhibin in ferret and canine adre- nocortical tumors contrast those of adrenocortical tumors that rise after gonadectomy in inhibin-a knockout mice [23]. Increased INHA mRNA levels are seen in human pe- diatric adrenocortical tumors [24]. Adult human adreno- cortical tumors are known to show inhibin-a expression, with a tendency toward stronger expression in virilizing tumors [25]. Intense staining of inhibin-B is also seen in the adrenocortical tumor cells of estrogen- and inhibin-B- secreting human adrenocortical tumors [26]. Ferrets may thus reflect more closely the human than the murine sit- uation with respect to inhibin expression in androgen- and estrogen-producing adrenocortical tumors.
Our study has also some limitations such as the fact that only a small number of male ferrets could be used as control group. However, the adrenocortical tumors of the ferret present a clear switch in the expression of enzymes involved in the synthesis of androgens and even estrogen. The upregulation of INHA mRNA expression in adrenocortical
tumors contributes also to the gonadal-differentiated phenotype of the adrenal gland as neoplasia develops. Ferret adrenocortical tumors cells thus show gonadal char- acteristics, reminiscent to a common urogenital primordial cell. The association of the tumor with increased inhibin expression is also seen in human pediatric adrenocortical tumors and human adult sex steroid-secreting adrenocor- tical tumors [24-26]. Ferrets may reflect, therefore, these human situations and may provide an attractive model for further research.
Acknowledgments
The authors thank Ms A. Slob, Ms E.P.M Timmermans- Sprang, Ms M.E. van Wolferen, Mrs J. Conley, and Dr K.J. Teerds for their skillful technical assistance and contribu- tions to this study.
References
[1] Schoemaker NJ, Schuurmans M, Moorman H, Lumeij JT. Correlation between age at neutering and age at onset of hyperadrenocorticism in ferrets. J Am Vet Med Assoc 2000;216:195-7.
[2] Rosenthal KL, Peterson ME. Evaluation of plasma androgen and es- trogen concentrations in ferrets with hyperadrenocorticism. J Am Vet Med Assoc 1996;209:1097-102.
[3] Schoemaker NJ, Teerds KJ, Mol JA, Lumeij JT, Thijssen JH, Rijnberk A. The role of luteinizing hormone in the pathogenesis of hyper- adrenocorticism in neutered ferrets. Mol Cell Endocrinol 2002;197: 117-25.
[4] Keegan CE, Hammer GD. Recent insights into organogenesis of the adrenal cortex. Trends Endocrinol Metab 2002;13:200-8.
[5] Bielinska M, Parviainen H, Kiiveri S, Heikinheimo M, Wilson DB. Review paper: origin and molecular pathology of adrenocortical neoplasms. Vet Pathol 2009;46:194-210.
[6] Johnsen IK, Slawik M, Shapiro I, Hartmann MF, Wudy SA, Looyenga BD, Hammer GD, Reincke M, Beuschlein F. Gonadectomy in mice of the inbred strain CE/J induces proliferation of sub- capsular adrenal cells expressing gonadal marker genes. J Endo- crinol 2006; 190:47-57.
[7] Nguyen AD, Conley AJ. Adrenal androgens in humans and nonhuman primates: production, zonation and regulation. Endocr Dev 2008;13:33-54.
[8] Hofland J, de Jong FH. Inhibins and activins: their roles in the ad- renal gland and the development of adrenocortical tumors. Mol Cell Endocrinol 2012;359:92-100.
[9] Rainey WE, Nakamura Y. Regulation of the adrenal androgen biosynthesis. J Steroid Biochem Mol Biol 2008;108:281-6.
[10] Wagner S, Kiupel M, Peterson 2nd RA, Heikinheimo M, Wilson DB. Cytochrome b5 expression in gonadectomy-induced adrenocortical
neoplasms of the domestic ferret (Mustela putorius furo). Vet Pathol 2008;45:439-42.
[11] Bielinska M, Kiiveri S, Parviainen H, Mannisto S, Heikinheimo M, Wilson DB. Gonadectomy-induced adrenocortical neoplasia in the domestic ferret (Mustela putorius furo) and laboratory mouse. Vet Pathol 2006;43:97-117.
[12] Peterson II RA, Kiupel M, Bielinska M, Kiiveri S, Heikinheimo M, Capen CC, Wilson DB. Transcription factor GATA-4 is a marker of anaplasia in adrenocortical neoplasms of the domestic ferret (Mustela putorius furo). Vet Pathol 2004;41:446-9.
[13] Schoemaker NJ, Kuijten AM, Galac S. Luteinizing hormone- dependent Cushing’s syndrome in a pet ferret (Mustela putorius furo). Domest Anim Endocrinol 2008;34:278-83.
[14] Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002;30:e36.
[15] Mapes S, Corbin CJ, Tarantal A, Parker CR, Conley A. Cytochrome b5 (b5) in the developing rhesus adrenal. Endocr Res 2002;28:623.
[16] Manna PR, Dyson MT, Stocco DM. Regulation of the steroidogenic acute regulatory protein gene expression: present and future per- spectives. Mol Hum Reprod 2009;15:321-33.
[17] Bassett MH, Mayhew B, Rehman K, White PC, Mantero F, Arnaldi G, Stewart PM, Bujalska I, Rainey WE. Expression profiles for ste- roidogenic enzymes in adrenocortical disease. J Clin Endocrinol Metab 2005;90:5446-55.
[18] Dharia S, Slane A, Jian M, Conner M, Conley AJ, Parker Jr CR. Colocalization of P450c17 and cytochrome b5 in androgen- synthesizing tissues of the human. Biol Reprod 2004;71:83-8.
[19] Conley A, Hinshelwood M. Mammalian aromatases. Reproduction 2001;121:685-95.
[20] Moreau F, Mittre H, Benhaim A, Bois C, Bertherat J, Carreau S, et al. Aromatase expression in the normal human adult adrenal and in adrenocortical tumors: biochemical, immunohistochemical, and molecular studies. Eur J Endocrinol 2009; 160:93-9.
[21] Conley AJ, Pattison JC, Bird IM. Variations in adrenal androgen production among (nonhuman) primates. Semin Reprod Med 2004; 22:311-26.
[22] Peterson II RA, Kiupel M, Capen CC. Adrenal cortical carcinomas with myxoid differentiation in the domestic ferret (Mustela putor- ius furo). Vet Pathol 2003;40:136-42.
[23] Kananen K, Rilianawati, Paukku T, Markkula M, Rainio EM, Huhtaniemi I. Suppression of gonadotropins inhibits gonadal tumorigenesis in mice transgenic for the mouse inhibin alpha- subunit promoter/simian virus 40 T-antigen fusion gene. Endocri- nology 1997;138:3521-31.
[24] Rich N, Gaston V, Le Bouc Y, Gicquel C. Expression of the gene for the alpha-subunit of inhibin in human adrenocortical tumours. Horm Res 2002;57:43-7.
[25] Arola J, Liu J, Heikkila P, Voutilainen R, Kahri A. Expression of inhibin alpha in the human adrenal gland and adrenocortical tumors. Endocr Res 1998;24:865-7.
[26] Fragoso MC, Kohek MB, Martin RM, Latronico AC, Lucon AM, Zerbini MC, Longui CA, Medonca BB, Domenice S. An inhibin B and estrogen-secreting adrenocortical carcinoma leading to selective FSH suppression. Horm Res 2007;67:7-11.