ELSEVIER
Contents lists available at ScienceDirect
Domestic Animal Endocrinology
journal homepage: www.domesticanimalendo.com
DOMESTIC ANIMAL ENDOCRINOLOGY
Short Communication
Expression of steroidogenic factor 1 in canine cortisol-secreting adrenocortical tumors and normal adrenals
Q4S. Galac*, M.M.J. Kool, M.F. van den Berg, J.A. Mol, H.S. Kooistra
Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands
ARTICLE INFO
Article history: Received 3 October 2013 Received in revised form 8 April 2014 Accepted 13 April 2014
Keywords: Cushing’s syndrome Metastasis Adrenal Dog
ABSTRACT
We report on a screening for the relative messenger RNA (mRNA) and protein expression of steroidogenic factor 1 (SF-1) in normal canine adrenals (n = 10) and cortisol-secreting adrenocortical tumors (11 adenomas and 26 carcinomas). The relative mRNA expression of SF-1 was determined by quantitative real-time polymerase chain reaction analysis and revealed no differences between normal adrenals, adenomas, and carcinomas. Immuno- histochemistry demonstrated SF-1 protein expression in a nuclear pattern throughout the normal adrenal cortex and a predominantly nuclear staining pattern in adrenocortical tumors. Of the 15 dogs available for follow up, 7 dogs developed hypercortisolism within 2.5 yr after adrenalectomy, with metastatic disease in 6 dogs and adrenocortical tumor regrowth in 1 dog. The relative SF-1 mRNA expression in dogs with early recurrence was greater (2.46-fold, P = 0.020) than in dogs in remission for at least 2.5 yr after adrenal- ectomy. In conclusion, we demonstrated the presence of SF-1 expression in normal canine adrenals and adrenocortical tumors. The high SF-1 mRNA expression in carcinomas with early recurrence might indicate its value as a prognostic marker, as well as its potential for therapeutic development.
@ 2014 Elsevier Inc. All rights reserved.
1. Introduction
Q2
Canine cortisol-secreting adrenocortical tumors (ATs) underlie ACTH-independent hypercortisolism and are characterized by uncontrolled growth and hormone secre- tion [1]. Their pathogenesis is largely unknown. Potential explanations for ACTH-independent hypersecretion of cortisol and growth of canine ATs can be derived from the current understanding of adrenal growth biology.
Adrenal development and steroidogenesis depend greatly on the expression of steroidogenic factor 1 (SF-1) [2]. Mice with homozygous null mutations in SF-1 are born without adrenal glands and gonads and die within hours after birth because of adrenal insufficiency [3,4]. In the adult adrenal cortex, SF-1 plays a prominent role in the regulation of steroidogenesis, by being an obligate activator of most of
Q1 * Corresponding author. Tel .: + 31 30 2539683; fax: E-mail address: sara.galac@gmail.com (S. Galac).
the cytochrome P450 steroid hydroxylases and steroidogenic acute regulatory (StAR) protein [5,6]. The growth-promoting effect of SF-1 in the adult adrenal gland is dosage dependent. For the compensatory growth of the contralateral adrenal gland following unilateral adrenalectomy, physiologic SF-1 expression is sufficient [7], whereas an increased dosage stimulates proliferation and decreases apoptosis in human adrenocortical cells and triggers adrenal tumorigenesis in mice [8]. In childhood ATs, SF-1 gene amplification and protein overexpression are the most consistent findings [9]. In adult humans with an adrenocortical carcinoma, SF-1 staining intensity is negatively correlated with survival, and SF-1 is considered a tumor stage-independent prog- nostic factor [10]. Taken together, this indicates that SF-1 plays an important role in the pathogenesis of ATs.
In dogs, the expression of SF-1 has been studied in sex- reversal syndrome only [11]. The aim of the present study was to determine the expression of SF-1 messenger RNA (mRNA) and protein in normal adrenals and cortisol- secreting ATs of dogs.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49
50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99
2. Materials and methods
2.1. Animals and tissues
The study was approved by the Ethical Committee of Utrecht University. Cortisol-secreting ATs were obtained from 37 dogs that underwent adrenalectomy at the Department of Clinical Sciences of Companion Animals and permission to use the AT tissue was obtained from all patient owners. The dogs’ ages at the time of surgery ranged from 6 to 14 yr (mean, 9 yr). Twelve dogs were mongrels and the others were of 10 different breeds. Eighteen of the dogs were male (8 castrated) and 19 female (15 neutered). The diag- nosis of ACTH-independent hypercortisolism was made as described previously [1,12]. Ten normal adrenal glands (whole tissue explants) of healthy beagle dogs served as control tissue. The dogs were euthanized for reasons unre- lated to the present study. Their ages ranged from 2 to 5 yr, there were 5 males and 5 females, all intact.
From 15 of 37 dogs, follow up information was available. When reoccurrence of ACTH-independent hypercortisolism was suspected, the diagnosis was confirmed by endocrine testing, measurements of the basal plasma ACTH concen- tration and diagnostic imaging [1,12]. The dogs were cate- gorized in (1) a group with relapse of ACTH-independent hypercortisolism within 2.5 yr after surgery; and (2) a group in remission for at least 2.5 yr after surgery.
2.2. Histopathology
All tissues were fixed in 4% buffered formalin, embedded in paraffin after at least 24 h and maximally 48 h of fixation, cut into 5-um sections, and mounted on SuperFrost Plus microscope slides (Menzel-Gläser, Braunsweig, Germany). On histopathology, there were 26 carcinomas and 11 adenomas. The diagnosis was made by a single pathologist. In case of doubt, a second pathologist was consulted and slides were reviewed at a multihead microscope, and a consensus was reached. In all carcinomas there was evidence of invasion of neoplastic cells into blood vessels and/or capsular invasion. Additional characteristics for carcinomas were trabecular growth pattern and peripheral fibrosis. In agreement with the criteria published before [13], none of the adenomas excee- ded 2 cm diameter at the major axis width, whereas carci- nomas were generally larger. Typical histologic characteristics for adenomas were hematopoiesis, fibrin thrombi, and cyto- plasmic vacuolization, whereas hemorrhage, necrosis, and single cell necrosis were detected in both, adenomas and carcinomas.
2.3. Total RNA extraction and reverse transcription
Tissue fragments for RNA isolation were snap frozen in liquid nitrogen within 10 to 20 min after surgical removal and stored at -70℃ until RNA isolation. Total RNA isolation and complementary DNA synthesis were performed, as described previously [12].
2.4. Quantitative real-time polymerase chain reaction
Quantitative real-time polymerase chain reaction primers for SF-1 (XM_846937, forward: AGGGCTGCAAG-
GGGTTTTTCAA, reverse: CATCCCCACTGTCAGGCACTTCT, Ta: 59℃) were designed using Perl-primer v1.1.14 according to the Bio-Rad iCycler parameters, and ordered from Euro- gentec (Maastricht, the Netherlands). Polymerase chain re- action optimization and confirmation of primer specificity were performed as described previously [12].
The mRNA expression abundances of SF-1 were mea- sured in 10 normal adrenals and 37 cortisol-secreting ATs (26 carcinomas and 11 adenomas). All reactions were per- formed on a MyiQ Single-Color Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA), according to a previ- ously described protocol [12]. Ribosomal protein S5 (RPS5), ribosomal protein S19 (RPS19), and hypoxanthine-guanine phosphoribosyltransferase (HPRT) were used as reference genes [14]. Analysis of the relative expression abundances of the reference genes revealed no significant differences between groups and their expression was shown to be stable using GeNorm software, justifying their use as reference genes.
2.5. Immunohistochemistry
For IHC staining of SF-1, tissue slides were rehydrated in a series of xylene-alcohol baths. Antigen retrieval was performed using 10 mM sodium citrate buffer pH 6, for 20 min at 95℃. To block endogenous peroxidase activity, slides were incubated with peroxidase block (S2003, Dako, Glostrup Denmark) for 5 min. Aspecific binding sites were Q3 blocked with 10% normal goat serum in phosphate- buffered saline for 20 min. Slides were incubated over- night at 4℃ with a polyclonal rabbit-anti-human anti SF-1 antibody (LS- A5534, MBL International, USA), in a 1:200 dilution in 1% normal goat serum in phosphate-buffered saline. Subsequently, all slides were incubated with anti- rabbit HRP conjugated secondary antibody (Dako K4003) for 45 min at room temperature. Antibody detection was performed using Dako K3468 HRP substrate. All slides were incubated with 3,3’-diaminobenzidine (Dako liquid DAB + substrate chromogen system, K3468, Dako) for 4 min and subsequently counterstained with hematoxylin, dehydrated, and mounted. To confirm the specificity of the reaction, blocking peptides against SF-1 were used (LS-P5534, MBL in a concentration of 1 mg/mL and a dilu- tion of 1:400). Preincubation of the antibody with those blocking peptides abolished all staining. IHC analysis was performed using light microscopy. The presence and localization (membranous, cytoplasmic, or nuclear) of staining in ATs and normal adrenals were described.
2.6. Statistical analyses
Statistical analyses were performed with SPSS20 (IBM, Armonk, NY, USA). Relative mRNA expression abundances were calculated using the 44-Ct method [15]. A Mann- Whitney U test was used to compare the relative exp- ression abundances of SF-1 between normal adrenals, adenomas and carcinomas, and between dogs with recur- rence of hypercortisolism within 2.5 yr and in dogs in remission for at least 2.5 yr after adrenalectomy. For the first comparison, a Bonferroni correction was applied and
100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160
161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221
P < 0.025 was considered significant, whereas for the latter comparison, a P value < 0.05 was considered significant.
3. Results
Relative mRNA expression abundances of SF-1 in normal adrenal glands did not differ from those in ade- nomas and carcinomas. SF-1 protein was expressed in all normal adrenals and ATs. IHC demonstrated predominantly nuclear staining in normal adrenals, with the strongest intensity in the zona glomerulosa and zona fasciculata (Fig. 1A). In most adrenocortical adenomas and carcinomas the SF-1 positive cells showed nuclear staining and occa- sionally a cytoplasmic immunoreactivity was observed (Fig. 1B and C).
All 15 dogs from which follow up information was available were diagnosed with carcinoma. In a group of dogs with short survival, 7 dogs had reoccurrence of ACTH- independent hypercortisolism from 3 to 24 mo after surgery. Besides the physical and biochemical changes associated with hypercortisolism, liver and/or lung metas- tasis were detected in 6 of these dogs at the time of evaluation. In 1 dog regrowth of the AT was seen by ul- trasonography. In 8 of the dogs in remission for at least 2.5 yr after surgery, 2 dogs are still alive (54 and 60 mo post adrenalectomy), and 5 dogs were euthanized because of reasons unrelated to hypercortisolism (range 45-72 mo post adrenalectomy). In 1 dog there was a reoccurrence of
hypercortisolism because of the cortisol-secreting AT in a contralateral adrenal gland (35 mo post adrenalectomy) and the dog has been treated medically with trilostane. The relative mRNA expression abundances of SF-1 were greater (2.46-fold, P = 0.020) in the group with recurrence of hypercortisolism within 2.5 yr than in the group of dogs that were in remission at least 2.5 yr after surgery.
4. Discussion
Increasing evidence of the importance of SF-1 in adre- nocortical tumorigenesis in humans and mice motivate the relevance to study its expression in canine ATs [8-10]. In the present study, the relative SF-1 mRNA expression in normal adrenals and cortisol-secreting ATs does not differ and yet high SF-1 expression is associated with poor clinical outcome. At a glance, this may seem contradictory, how- ever, it could be related to the functional role of SF-1, which clearly depends on the cellular context [2,6]. In the normal adult differentiated adrenocortical cell, the major role of SF-1 is the regulation of steroidogenesis. In fetal adrenal development, that is, nondifferentiated cells, SF-1 stimu- lates adrenal growth, independent of steroid synthesis [16,17]. Hypothetically, carcinomas might dedifferentiate toward a more fetal phenotype. Apart from expression also activation by yet unknown mechanisms may play a role [18]. Another possible explanation could lie in the fact that whole tissue explants of normal adrenals were used as a
A
B
100 um,
50 um
C
0
50 um
web 4C/FPO
222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282
283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343
control. It is possible, that the results would have been different when AT tissue would be compared with zona fasciculata only.
In the group of ATs with poor outcome, that is, the recurrence of hypercortisolism within 2.5 yr after surgery, and high relative SF-1 expression metastases were present in most dogs. In 1 dog, the recurrence of hypercortisolism was associated with AT in the contralateral adrenal gland 35 mo after surgery. The possibility, that this AT was the metastasis of the previously removed AT seems unlikely, although it could not be completely excluded [13,19]. Bilateral adrenal gland involvement in this case is also possible. Angiogenesis is paramount in tumor development and metastasis, with angiopoietin 2 (ANGPT2) being a key player. Using a ChIP-on-chip approach, a SF-1-binding re- gion was identified in the human ANGPT2 promoter, and SF-1-dependent activation of ANGPT2 transcription was confirmed in luciferase assays [20]. This provides evidence of ANGPT2 as an important target of SF-1 in the adrenal gland and suggests that the regulation of angiogenesis in ATs might be related to SF-1 expression. Recent research demonstrated elevated abundances of ANGPT2 in canine cortisol-secreting ATs [21], and studies about the link be- tween ANGPT2 and SF-1 are warranted.
Immunohistochemistry demonstrated a predomi- nantly nuclear pattern of SF-1 staining. This is in agree- ment with the data in other species. The occasional cytoplasmic staining observed, could be ascribed to the use of a polyclonal antibody [22]. In human adrenocortical carcinoma, there is a negative association between the SF- 1 staining intensity and survival, which resulted in the inclusion of SF-1 IHC among the prognostic factors [10]. In the present study, the low number of dogs available for follow up was a limiting factor to objectively assess the prognostic value of SF-1 staining. A multicenter approach including large numbers of dogs with cortisol-secreting ATs should be set up in the future to test the usage of SF-1 mRNA and/or protein expression as a prognostic marker.
Recently, drugs targeting SF-1 activity have been developed. Isoquinolinone compounds, so called SF-1 in- verse agonists, inhibit the constitutive transcriptional ac- tivity of SF-1. They have been shown to selectively inhibit cell proliferation in a human adrenocortical cell line and to inhibit steroid hormone secretion [23,24]. Based on the results of the present study, drugs targeting SF-1 may be beneficial in medical management of at least a subgroup of canine ATs. In vitro studies on primary canine AT cell cul- tures are warranted to evaluate their effect on steroido- genesis and proliferation and disclose their therapeutic potential.
In conclusion, our study demonstrated SF-1 expression in normal adrenals and cortisol-secreting ATs and suggests that SF-1 might possess a prognostic value and could be an attractive target for a medical approach.
Acknowledgments
The authors have no conflicts of interest to declare that could be perceived as prejudicing the impartiality of the research reported.
S. Galac contributed to the conception and design of the study, data acquisition, analysis and interpretation, drafting the manuscript, and final approval of the defin- itive version. M.M.J. Kool contributed to the conception and design of the study, data analysis and interpretation, critical revision of the manuscript, and final approval of the definitive version. M.F. van den Berg contributed to the conception and design of the study, interpretation of data, critical revision of the manuscript, and final approval of the definitive version. J.A. Mol contributed to the conception and design of the study, interpretation of data, critical revision of the manuscript, and final approval of the definitive version. H.S. Kooistra contrib- uted to the conception and design of the study, critical revision of the manuscript, and final approval of the definitive version.
References
[1] Galac S, Reusch C, Kooistra HS, Rijnberk A. Adrenals. In: Rijnberk A, Kooistra HS, editors. Clinical endocrinology of dogs and cats. Hannover: Schlütersche; 2010. pp. 93-154.
[2] 2] Parker KL, Rice DA, Lala DS, Ikeda Y, Luo X, Wong M, Bakke M, Zhao L, Frigeri C, Hanley NA, Stallings N, Schimmer BP. Steroido- genic factor 1: an essential mediator of endocrine development. Recent Prog Horm Res 2002;57:19-36.
[3] Sadovsky Y. Mice deficient in the orphan receptor steroidogenic factor 1 lack adrenal glands and gonads but express P450 side- chain-cleavage enzyme in the placenta and have normal embry- onic serum levels of corticosteroids. Proc Natl Acad Sci 1995;92: 10939-43.
[4] Sadovsky Y, Dorn C. Function of steroidogenic factor 1 during development and differentiation of the reproductive system. Rev Reprod 2000;5:136-42.
[5] Schimmer BP, White PC. Minireview: steroidogenic factor 1: its roles in differentiation, development, and disease. Mol Endocrinol 2010; 24:1322-37.
[6] Gummow BM, Scheys JO, Cancelli VR, Hammer GD. Reciprocal regulation of a glucocorticoid receptor-steroidogenic factor-1 tran- scription complex on the Dax-1 promoter by glucocorticoids and adrenocorticotropic hormone in the adrenal cortex. Mol Endocrinol 2006;20:2711-23.
[7] Beuschlein F, Mutch C, Bavers DL, Ulrich-Lai YM, Engeland WC, Keegan C, Hammer GD. Steroidogenic factor-1 is essential for compensatory adrenal growth following unilateral adrenalectomy. Endocrinology 2002;143:3122-35.
[8] Doghman M, Karpova T, Rodrigues GA, Arhatte M, De Moura J, Cavalli LR, Virolle V, Barbry P, Zambetti GP, Figureido BC, Heckert LL, Lalli E. Increased steroidogenic factor-1 dosage trig- gers adrenocortical cell proliferation and cancer. Mol Endocrinol 2007;21:2968-87.
[9] Figueiredo BC, Cavalli LRPM. SF-1 overexpression in childhood adrenocortical tumours. J Clin Endocrinol Metab 2005;90:615-9.
[10] Sbiera S, Schmull S, Assie G, Voelker HU, Kraus L, Beyer M, Ragazzon B, Beuschlein F, Willenberg HS, Hahner S, Saeger W, Bertherat J, Allolio B, Fassnacht M. High diagnostic and prognostic value of steroidogenic factor-1 expression in adrenal tumors. J Clin Endocrinol Metab 2010;95:161-71.
[11] Kothapalli K, Kirkness E, Pujar S, Van Wormer R, Meyers-Wallen VN. Exclusion of candidate genes for canine SRY-negative XX sex reversal. J Hered 2005;96:759-63.
[12] Galac S, Kool MMJ, Naan EC, Daminet S, Mol JA, Kooistra HS. Expression of the ACTH receptor, steroidogenic acute regulatory protein, and steroidogenic enzymes in canine cortisol-secreting adrenocortical tumors. Domest Anim Endocrinol 2010;39:259-67.
[13] Labelle P, Kyles AE, Farver TB, De Cock HE. Indicators of malignancy of canine adrenocortical tumors: histopathology and proliferation index. Vet Pathol 2004;41:490-7.
[14] Brinkhof B, Spee B, Rothuizen J, Penning LC. Development and evaluation of canine reference genes for accurate quantification of gene expression. Anal Biochem 2006;356:36-43.
[15] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-Delta Delta CT Method. Methods 2001;25:402-8.
344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404
405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465
[16] Staels B, Hum DW, Miller WL. Regulation of steroidogenesis in NCI- H295 cells: a cellular model of the human fetal adrenal. Mol Endocrinol 1993;7:423-33.
[17] Looyenga BD, Hammer GD. Origin and identity of adrenocortical tumors in inhibin knockout mice: implications for cellular plasticity in the adrenal cortex. Mol Endocrinol 2006;20:2848-63.
[18] Wang CY, Chen WY, Lai PY, Chung B. Distinct functions of ste- roidogenic factor-1 (NR5A1) in the nucleus and the centrosome. Mol Cel Endocrinol 2013;371:148-53.
[19] Massari F, Nicoli S, Romanelli G, Buracco P. Adrenalectomy in dogs with adrenal gland tumors: 52 cases (2002-2008). J Am Vet med Assoc 2011;239:216-21.
[20] Ferraz-de-Souza B, Lin L, Shah S, Jina N, Hubank M, Dattani MT, Acherman JC. ChIP-on-chip analysis reveals angiopoietin 2 (Ang2, ANGPT2) as a novel target of steroidogenic factor-1
(SF-1, NR5A1) in the human adrenal gland. FASEB J 2010;25: 1166-75.
[21] Kool MM, Galac S, Kooistra HS, Mol JA. Expression of angiogenesis- related genes in canine cortisol-secreting adrenocortical tumors. Domest Anim Endocrinol; 2014. http://dx.doi.org/10.1016/j.doma- niend.2013.11.004.
[22] Duregon E, Volante M, Giorcelli J, Terzolo M, Lalli E, Papotti M. Diagnostic and prognostic role of steroidogenic factor 1 in adreno- cortical carcinoma: a validation study focusing on clinical and pathologic criteria. Hum Pathol 2013;44:822-8.
[23] Doghman M, Cazareth J, Douguet D, Madoux F, Hodder P, Lalli E. In- hibition of adrenocortical carcinoma cell proliferation by steroidogenic factor-1 inverse agonists. J Clin Endocrinol Metab 2009;94:2178-83.
[24] Piu F, Del Tredici AL. Inverse agonist activity of steroidogenic factor SF-1. Methods Enzymol 2010;485:245-59.
UNCORRECTED PROOP
466 467 468 469 470 471 472 473 474 475 476
477 478 479 480 481 482 483 484 485 486 487