Crosstalk Between Glycoxidative Modification of Low- Density Lipoprotein, Angiotensin II-Sensitization, and Adrenocortical Aldosterone Release
Authors S. Saha, S. R. Bornstein, J. Graessler, S. Kopprasch
Affiliation
Department of Internal Medicine 3, Carl Gustav Carus Medical School, Technische Universität Dresden, Dresden, Germany
Key words
@ low-density lipoprotein
· glycoxidative lipoprotein modification
aldosterone
· Janus kinase
· protein kinase A
Abstract
▼
Low-density lipoprotein (LDL) is considered to be a risk factor for atherosclerosis. In the presence of hyperglycemia, LDL undergoes glycoxidative modification and this glycoxidized (glycox) LDL promotes atherosclerosis in type 2 diabetic (T2D) individuals. Moreover, because of its cholesterol content, LDL contributes to aldosterone biosyn- thesis, which is modulated by angiotensin II (AngII) and has been implicated in cardiovascular complications of T2D. However, the molecular mechanism of the crosstalk between glycoxLDL, AngII, and aldosterone has not been explained clearly. Therefore, this study has been aimed to investigate the impact of in vitro modified gly- coxLDL on aldosterone release in an AngII-sensi- tized adrenocortical carcinoma cell line (NCI H295R). Native LDL (natLDL), isolated from healthy volunteers by sequential density gradi- ent ultracentrifugation, was subjected to D-glu- cose (200 mmol/l), for glycoxidative modification,
at 37℃ for 6 days. The AngII-sensitized H295R cells were treated with natLDL and glycoxLDL for 24h and the supernatant was used for aldoster- one measurement. The treated cells were utilized for protein isolation and mRNA quantification. Compared to natLDL, glycoxLDL produced a sig- nificantly greater effect on aldosterone release from AngII-sensitized cells. The treatment with specific pharmacological inhibitors suggests that modified LDL recruits ERK1/2 and janus kinase-2 for transcriptional regulation of aldosterone syn- thase. Moreover, glycoxLDL modulates aldoster- one release via cAMP-dependent protein kinase A (PKA) pathway. However, glycoxLDL induces ERK phosphorylation independent of PKA activa- tion and this novel mechanism could be targeted for therapeutic trials. In conclusion, this in vitro study emphasizes a possible causal relationship between LDL glycoxidative modification, AngII- sensitization, and adrenocortical steroid hor- mone release.
Downloaded by: University of Pittsburgh. Copyrighted material.
received 23.06.2014 accepted 28.10.2014
Bibliography
DOI http://dx.doi.org/ 10.1055/s-0034-1395568 Published online: January 20, 2015 Horm Metab Res 2015; 47: 855-860 @ Georg Thieme Verlag KG Stuttgart . New York ISSN 0018-5043
Correspondence
Dr. S. Kopprasch Pathological Biochemistry Department of Internal Medicine 3 Technische Universität Dresden Carl Gustav Carus Medical School Fetscherstraße 74 01307 Dresden Germany Tel .: +49/351/4584 523 Fax: +49/351/4585 330
Steffi.Kopprasch@uniklinikum- dresden.de
Introduction
▼
The principal mineralocorticoid, aldosterone, is synthesized in the zona glomerulosa of adrenal cortex utilizing the common precursor, choles- terol, which is primarily derived from circulating lipoproteins such as high-density lipoproteins (HDL) and low-density lipoproteins (LDL) [1]. In humans, LDL is the major lipoprotein carrying cholesterol, and therefore, LDL may primarily contribute to cholesterol supply for steroidogen- esis [2]. Aldosterone is implicated in the induc- tion of structural and functional alterations in the heart, kidney, and blood vessels leading to the development of myocardial fibrosis, nephro- sclerosis, and vascular inflammation [3]. In addi- tion to circulating lipoproteins, aldosterone biosynthesis is also modulated by the vasocon-
strictor angiotensin II (AngII). Moreover, the overactivity of the renin-angiotensin-aldoster- one system (RAAS) has been causally associated with type 2 diabetis mellitus (T2D) and its meta- bolic complications [4]. In the presence of hyper- glycemia, a characteristic feature of T2D, LDL undergoes glycoxidative modification and thus eventually forms advanced glycation end prod- ucts (AGE) such as Nº-(carboxymethyl)lysine (CML) and Ne-(carboxyethyl)lysine (CEL) [5] resulting in increased incidence of atherosclero- sis. Furthermore, enhanced glycoxidation of cir- culating LDL has also been demonstrated in impaired glucose tolerance individuals [6].
Very recently, we have shown that glycoxida- tively modified HDL augments steroidogenesis in AngII-sensitized adrenocortical cells [7]. We have also shown that in the absence of AngII, glycox-
LDL is able to induce aldosterone release from adrenocortical cells [8]. It has also been documented by our group that the degree of LDL oxidation is inversely related to the adrenocortical aldosterone release [9] and thus, the heavily oxidized LDL had the lowest stimulatory effects. Moreover, the in vivo glycoxida- tive modification of LDL has also been demonstrated to have a lesser stimulatory effect on steroid hormone release than very low-density lipoprotein (VLDL) [10]. However, the molecular mechanism of the impact of in vitro LDL glycoxidative modifica- tion and AngII-sensitization on adrenocortical aldosterone release has yet to be determined. Therefore, the present study has been aimed to demonstrate the effect of in vitro modified glycoxidized LDL on AngII-sensitized NCI H295R cells with respect to aldosterone release and its underlying molecular mechanism.
Methods
▼
Lipoprotein preparation, modification, and characterization
Native LDL (natLDL) was isolated from the blood, preserved in ethylenediaminetetraacetic acid (EDTA), of overnight fasting healthy volunteers by sequential density gradient ultracentrifu- gation as previously described [11]. Prior to glycoxidation, pro- tein content of LDL was equalized to 1.0g/l after dilution with phosphate buffered saline (PBS, pH=7.2) and dialyzed against 200 mmol/l D-glucose at 37℃ for 6 days resulting in the forma- tion of glycoxidized LDL (glycoxLDL). Finally, LDL was diluted to 0.6g/l protein. LDL protein and lipid modifications were rou- tinely assessed by determination of fluorescent products with an emission maximum at 430 nm when excited at 365 nm [12], by carbonyl formation according to Levine et al. [13] and by accumulation of thiobarbituric acid-reactive substances (TBARS) as described by Yagi [14], and as described previously [8].
Cell culture, treatment, and inhibition assay
Human adrenocortical cells (H295R) were cultured in DMEM (Sigma)/F12 (Invitrogen) medium, supplemented with insulin (66umol/l), hydrocortisone (10umol/l), 17B-estradiol (10umol/l), apo-transferrin (10µg/ml), sodium selenite (30umol/l), 2% FCS (Biochrom) along with penicillin (100 units), and streptomycin (100µg/ml) at 37℃ in a humidified atmosphere of 95% air with 5% CO2. Cells were seeded at a density of 70000 cells per cm2 and allowed to grow until 80% confluence. Cells were then incu- bated with AngII for 24h, followed by natLDL or glycoxLDL for the next 24h in serum-free media (SFM) in order to measure aldosterone released in the media. Subsequently the cells were utilized for protein extraction and RNA isolation. For investiga- tion of signaling mechanism, nonsensitized cells were treated with natLDL or glycoxLDL in the presence or absence of specific blockers for 24h in order to obtain exclusive effects of lipoproteins. All experiments were performed in duplicate in order to exclude the technical error during seeding and treatment of cells with lipoproteins and blockers. Specific pharmacological inhibitors, such as MEK inhibitor U0126 [1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadi- ene], p38 MAPKinase inhibitor SB203580 [4-(4-fluorophenyl)- 2-(4-methylsulfinylphenyl)-5-(4-pyridyl)-1H-imidazole · HCl], protein kinase C (PKC) inhibitor bis-indolylmaleimide I {2-[1-(3-dimethylaminopropyl)-1H-indol-3-yl]-3-(1H-indol-
3-yl) maleimide. HCI}, and Janus kinase-2 inhibitorAG490 (N-benzyl-3,4-dihydroxy-a-cyanocinnamide) were obtained from Calbiochem (Darmstadt, Germany). Following the treat- ment of cells with inhibitors, the viability of the cells was assessed by trypan blue viability test. This test showed that 85-90% cells were viable, which ensures that the decreased release of aldosterone was due to the effect of the inhibitors and not due to the decreased number of cells. In order to exclude the possibility of nonspecific effect of inhibitors, cells were treated only in the presence or absence of specific inhibitors and AngII or Forsokolin had been used as positive control, wherever it was appropriate. In preliminary experiments, cells were treated with different concentrations of pharmacological inhibitors in order to find out the appropriate dose so that the distinct pathways were sufficiently blocked.
Aldosterone measurement
Aldosterone release in cell culture medium was quantified in duplicate by radioimmunoassay (RIA) using Diagnostic Systems Laboratories kit.
Western blotting analysis
Protein concentration of the whole cell-lysates of H295R was quantified by bicinchoninic acid (BCA)™ protein assay kit (Pierce, USA). The denatured proteins were resolved electropho- retically [15] and the separated protein was then transferred onto a polyvinylidene difluoride membrane (Roti-PVDF). The membranes were probed overnight with antibody for specific protein phospho-extracellular signal regulated kinases (PERK1/2), (1:1 000, Cell Signaling Technologies, Germany). Nor- malization of protein loading was assessed using ß-actin anti- body (1:1000, Cell Signaling) as a control. The protein was detected by chemiluminescence using Supersignal West Pico Chemiluminescent substrate kit (Pierce) and densitometric analysis was carried out utilizing Genetool analysis software (GeneGenome; Syngene, UK).
RNA isolation and quantitative real-time PCR
After specific treatment with LDL and pharmacological inhibi- tors, H295R cells were utilized for RNA isolation using High Pure RNA Isolation kit (Roche). cDNA was prepared from total RNA by reverse transcription with M-MLV Reverse Transcriptase (Invitrogen) and real-time PCR was performed by Light Cycler 480 SYBR Green I Master kit (Roche). Primers used for amplifica- tion of the specific segments of respective cDNA are listed in . Table 1. Differences in gene expression, expressed as fold of control, were calculated using the 2-Act method where human B-actin was used as housekeeping gene.
Statistics
Comparison between 2 groups was carried out by Student’s t-test. Kolmogorov-Smirnov test was used to validate normal distribution of all data. A p-value less than 0.05 was considered to be statistically significant. All data are presented as mean ± standard error of mean (SEM).
| hß-actin-F | CCAACCGCGAGAAGATGA |
| hß-actin-R | CCAGAGGCGTACAGGGATAG |
| hCyp11B2-F | CCTGTTGAAGGCGGAACTGTCACTA |
| hCyp11B2-R | AAAGAGCGTCATCAGCAAGGGAAAC |
Results
▼
As described previously [8], exposure of LDL to high glucose lev- els was accompanied by a mild elevation of fluorescence prod- ucts and protein carbonyl content. TBARS levels were significantly elevated (almost 5-fold) in glycoxLDL preparations.
GlycoxLDL promotes substantial increase in aldosterone release from AngII-sensitized H295R cells In order to observe the effect of LDL on sensitized cells, H295R cells were pre-incubated with AngII (100 nmol/l) for 24h. The supernatant was discarded and these cells were subsequently incubated with 100µg/ml natLDL or glycoxLDL for the next 24h. The aldosterone determination by RIA revealed that native and glycoxidized LDL induced significant increase in aldosterone release in both AngII-sensitized and nonsensitized H295R cells. In comparison with native LDL, glycoxLDL produced a 2-fold higher effect in AngII-sensitized cells (· Fig. 1).
Modified LDL recruits ERK1/2 for transcriptional regulation of aldosterone synthase
In our previous study [8] we have shown that glycoxLDL involves ERK1/2 for adrenocortical aldosterone release. In order to inves- tigate the role of MAP kinase in transcriptional regulation of aldosterone synthase, H295R cells were treated with all indi- cated forms of LDL with or without U0126 (10umol/l), the inhib- itor of ERK upstream kinase MEK, for 24h. The whole cell lysates were used for quantification of Cyp11B2 mRNA abundance by real-time PCR. As shown in · Fig. 2a, U0126 caused an impair- ment of Cyp11B2 mRNA levels in response to native and glycox- idized LDL, indicating the involvement of ERK1/2 at the transcriptional regulation of LDL-mediated aldosterone secre- tion. Simultaneous immunoblot analysis (· Fig. 2b) and subse- quent densitometric analysis ( Fig. 2c) reveal that treatment with U0126 caused nearly complete inhibition of LDL-induced ERK1/2 phosphorylation.
6000
Aldosterone release (pmol/l)
§
5000
with out Angll
with Angll
4000
3000
**
2000
1000
0
C
natLDL
glycoxLDL
LDL involves cAMP-dependent protein kinase A (PKA) for modulation of adrenocortical hormone release
In order to investigate the upstream regulator of MAP kinases the cells were treated with LDL in presence or absence of PKA inhibitor H89 (10umol/l) and protein kinase C (PKC) inhibitor bis-indolylmaleimide (BIM, 2umol/l) for 24h and the condi- tioned media was used for aldosterone measurement. BIM pro- duced significant inhibitory effect only on natLDL-mediated aldosterone release (· Fig. 3a) whereas PKA inhibitor H89 sig- nificantly reduced both native and modified forms of LDL-medi- ated adrenocortical steroidogenesis ( Fig. 3b). This indicates that the action of glycoxLDL is dependent only on PKA activation and natLDL involves both PKA and PKC for steroid hormone release in adrenocortical cells.
H89 is a nonspecific inhibitor of PKA [16]. In order to confirm the observation made with H89 and to evaluate the specific involve-
a
14
without U0126
12
with U0126
CYP11B2 mRNA (fold of control)
I
10
glycoxLDL + + Without Blocker 12 With U0126 With AG490 Downloaded by: University of Pittsburgh. Copyrighted material. — — —
*
8
*
6
4
NS
2
0
C
natLDL
b
PERK1/2
B-Actin
natLDL
+
+
+
—
—
—
glycoxLDL
+
+
+
—
—
—
U0126
+
+
—
—
—
—
AG490
+
+
—
—
—
—
H89
+
—
—
—
—
—
c
160
ERK1/2 phosphorylation (% of natLDL without blocker)
140
120
100
80
60
40
= With H89
20
0
natLDL
glycoxLDL
a
600
Aldosterone release (pmol/l)
Without BIM
500
T
With BIM
Y
*
NS
400
300
200
NS
**
100
I
T
0
C
Angll
natLDL
glycoxLDL
Aldosterone release (pmol/l)
700
600
Without H89
T
**
I
500
With H89
I
*
400
300
200
*
100
7
NS
0
C
FSK
natLDL
glycoxLDL
Aldosterone release (pmol/l) ^
800
700
T
600
Without RpcAMP
T
500
With RpcAMP
**
400
T
300
200
100
NS
0
c
natLDL
glycoxLDL
ment of cyclic adenosine monophosphate (cAMP) in LDL-mediated aldosterone release, the H295R cells were treated with or without CAMP analogue Rp-cAMP (1 mmol/l) in the presence of native and glycoxLDL for 24h and aldosterone release was measured in super- natants. . Fig. 3c reveals that the Rp-cAMP interfered with aldosterone release in a similar way like PKA inhibitor H89.
LDL recruits Janus kinase-2 (Jak-2) for steroidogenesis Previous studies revealed that glycoxidized HDL requires Janus kinase for adrenocortical steroidogenesis [7] and macrophage adhesion to endothelial cells [17]. In order to investigate the involvement of Jak-2 in LDL-mediated mineralocorticoid secre- tion, cells were treated with LDL with or without Jak-2 inhibitor AG490 (50umol/l) for 24h and the conditioned medium was used for aldosterone determination. . Fig. 4a, b show that AG490 caused significant inhibition of both native and modified LDL-mediated aldosterone release and Cyp11B2 mRNA level indicating the involvement of Jak-2 for steroid hormone release in adrenocortical cells.
a
700
Aldosterone release (pmol/l)
600
T
without AG490
500
with AG490
400
300
200
**
**
100
*
NS
I
0
C
Angli
natLDL
glycoxLDL
CYP11B2 mRNA (fold of control)
14
12
without AG490
10
with AG490
8
6
*
*
4
2
NS
0
C
natLDL
glycoxLDL
c
glycox LDL
PKA
Jak-2
ERK 1/2
?
mRNA transcription
Aldosterone release
MAP kinase is employed as a potential downstream target of Jak-2 but not that of PKA in response to native and modified LDL-mediated ERK phosphorylation It has been documented that Jak-2 can activate both STAT, as well as MAP kinase, as its downstream effectors [18]. Similarly, PKA also can recruit ERK1/2 as its downstream modulator [19,20]. Hence, in order to study the involvement of ERK1/2 in
Downloaded by: University of Pittsburgh. Copyrighted material.
Jak-2, as well as PKA-dependent pathways, cells were treated with native and glycoxLDL (100 µg/ml) in the presence or absence of Jak-2 inhibitor AG490 (50umol/l) or PKA inhibitor H89 (10umol/l) for a period of 10 min. Then, the whole cell lysates were immunoblotted and probed for pERK protein. · Fig. 2b, c (densitometric analysis) demonstrate significant impairment of ERK phosphorylation by AG490, while H89 could not produce inhibition. This implies that glycoxLDL-mediated PKA-dependent steroidogenesis does not involve ERK phosphorylation.
Discussion
▼
Metabolic syndrome is a frequent antecedent of T2D whose presence increases the risk of development of cardiovascular, cerebrovascular, and peripheral vascular diseases [21]. Diabetic dyslipidemia includes the appearance of small dense LDL parti- cles that are more susceptible to glycoxidative modification [22] and therefore, enhance their atherogenic potential. Various studies suggest that glycoxLDL promotes the development of atherosclerotic lesions in diabetic individuals through inhibition of endothelium-dependent vasodilation, stimulation of super- oxide radical release and regulation of the expression of scaven- ger receptors in macrophages [23]. However, the molecular mechanisms of the biological effects of glycoxLDL are not entirely identified. Therefore, the present study has been designed to investigate a possible crosstalk between glycoxida- tion of LDL, AngII-sensitization, and aldosterone release, which could mediate cardiovascular complications in T2D.
The present study shows that the glycoxLDL-induced metabolic effects were similar to effects of natLDL. However, in AngII-sen- sitized cells glycoxLDL produced significantly more aldosterone than natLDL. On the contrary, in vivo modified LDL isolated from subjects with impaired glucose tolerance could not produce greater effects in AngII-sensitized adrenocortical carcinoma cell line compared to LDL isolated from individuals with normal glu- cose tolerance [10]. This discrepancy may be due to the fact that in vitro LDL modification in the presence of high glucose concen- trations may not always mimic the complex in vivo process of glycoxidation [24]. Moreover, in this study in vitro modification was performed in the presence of 200 mM glucose, which bio- chemically mimics overt diabetes mellitus rather than a predia- betic condition. In diabetic conditions, biochemical modification of lipoproteins is not only characterized by glycation but also by oxidation. In a previous study, we showed that in vitro oxida- tively modified LDL (oxLDL) evoked a lesser increase in adreno- cortical aldosterone release compared to natLDL [9]. However, the pretreatment with oxLDL enhanced sensitivity of cells to AngII [9] explaining the augmented adrenocortical steroid hor- mone release in metabolic disorders.
The susceptibility of LDL-induced aldosterone release to the spe- cific pharmacological inhibitors H89, U0126 and AG490 deci- phers a role of PKA, ERK1/2, and Jak-2 in the glycoxLDL-mediated steroidogenesis. However, the partial inhibition of ERK phos- phorylation by AG490 and lack of inhibition by H89 implies that Jak-2 employs ERK1/2 as its downstream effector but PKA works independent of ERK activation. Moreover, this partial inhibition by AG490 also indicates that LDL recruits not only ERK1/2 as a downstream effector of Jak-2 but also some other downstream effectors such as STAT3. The observed data provide evidence for the existence of a novel mode of aldosterone regulation via CAMP-PKA dependent and Jak-2-ERK1/2 dependent pathways. A
similar signaling mechanism was also demonstrated in very low density lipoprotein (VLDL)-mediated aldosterone release [25]. The putative signaling cascade regulated by glycoxidatively modified lipoproteins is presented as a schematic diagram in · Fig. 4c. The treatment with specific pharmacological inhibi- tors infers that all 3 lipoproteins (glycoxHDL, glycoxLDL, and gly- coxVLDL) recruit ERK1/2 for adrenortical steroidogenesis. Protein kinase C (PKC), as an upstream regulator for HDL-medi- ated aldosterone release, requires ERK phosphorylation [7] whereas, for glycoxLDL- and glycoxVLDL-mediated steroid hor- mone release, PKA works independent of ERK activation [25]. Therefore, our inhibitor study emphasizes the speculation of ERK1/2 blocker as a novel mode of therapy for aldosterone- mediated various complications in diabetes mellitus while unaf- fected PKA-dependent pathway would maintain the daily requirement of aldosterone for cardiovascular homeostasis.
In summary, the glycoxidative modification of LDL plays a cru- cial role in augmenting aldosterone release from AngII-sensi- tized H295R cells via a novel mode of signaling mechanisms where PKA works independent of ERK phosphorylation while Jak-2 signaling partially depends on ERK activation for glycox- LDL-stimulated adrenocortical aldosterone release. Further- more, LDL-mediated enhanced aldosterone release from AngII-sensitized cells once again supports the possible impor- tance of RAAS modulation in reducing morbidity and mortality in diabetic individuals [26].
Acknowledgements
▼
The authors would like to thank Martina Kohl, Sigrid Nitzsche, and Eva Schubert for their excellent technical support and Ryan Ban for careful reading of the manuscript.
Conflict of Interest
▼
The authors declare that they have no conflicts of interest that could be perceived as prejudicing the impartiality of the research reported.
References
1 Azhar S, Leers-Sucheta S, Reaven E. Cholesterol uptake in adrenal and gonadal tissues: the SR-BI and ‘selective’ pathway connection. Front Biosci 2003; 8: s998-s1029
2 Carr BR, Simpson ER. Lipoprotein utilization and cholesterol synthesis by the human fetal adrenal gland. Endocr Rev 1981; 2: 306-326
3 Krug AW, Ehrhart-Bornstein M. Aldosterone and metabolic syndrome: is increased aldosterone in metabolic syndrome patients an additional risk factor? Hypertension 2008; 51: 1252-1258
4 Henriksen EJ. Improvement of insulin sensitivity by antagonism of the renin-angiotensin system. Am J Physiol Regul Integrat Comparat Physiol 2007; 293: R974-R980
5 Veiraiah A. Hyperglycemia, lipoprotein glycation, and vascular disease. Angiology 2005; 56: 431-438
6 Graessler J, Pietzsch J, Westendorf T, Julius U, Bornstein SR, Kopprasch S. Glycoxidised LDL isolated from subjects with impaired glucose tol- erance increases CD36 and peroxisome proliferator-activator recep- tor gamma gene expression in macrophages. Diabetologia 2007; 50: 1080-1088
7 Saha S, Graessler J, Schwarz PE, Goettsch C, Bornstein SR, Kopprasch S. Modified high-density lipoprotein modulates aldosterone release through scavenger receptors via extra cellular signal-regulated kinase and Janus kinase-dependent pathways. Mol Cell Biochem 2012; 366: 1-10
8 Saha S, Willenberg HS, Bornstein SR, Graessler J, Kopprasch S. Diabetic lipoproteins and adrenal aldosterone synthesis - a possible patho- physiological link? Horm Metab Res 2012; 44: 239-244
9 Ansurudeen I, Pietzsch J, Graessler J, Ehrhart-Bornstein M, Saha S, Born- stein SR, Kopprasch S. Modulation of adrenal aldosterone release by oxidative modification of low-density lipoprotein. Am J Hypertens 2010; 23: 1061-1068
10 Saha S, Schwarz PE, Bergmann S, Bornstein SR, Graessler J, Kopprasch S. Circulating very-low-density lipoprotein from subjects with impaired glucose tolerance accelerates adrenocortical cortisol and aldosterone synthesis. Horm Metab Res 2013; 45: 169-172
11 Pietzsch J, Subat S, Nitzsche S, Leonhardt W, Schentke KU, Hanefeld M. Very fast ultracentrifugation of serum lipoproteins: influence on lipoprotein separation and composition. Biochim Biophys Acta 1995; 1254: 77-88
12 Maeba R, Shimasaki H, Ueta N. Conformational changes in oxidized LDL recognized by mouse peritoneal macrophages. Biochim Biophys Acta 1994; 1215: 79-86
13 Levine RL, Garland D, Oliver CN, Amici A, Climent I, Lenz AG, Ahn BW, Shaltiel S, Stadtman ER. Determination of carbonyl content in oxida- tively modified proteins. Meth Enzymol 1990; 186: 464-478
14 Yagi K. A simple fluorometric assay for lipoperoxide in blood plasma. Biochem Med 1976; 15: 212-216
15 Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227: 680-685
16 Garrel G, Simon V, Thieulant ML, Cayla X, Garcia A, Counis R, Cohen- Tannoudji J. Sustained gonadotropin-releasing hormone stimulation mobilizes the cAMP/PKA pathway to induce nitric oxide synthase type 1 expression in rat pituitary cells in vitro and in vivo at proestrus. Biol Reprod 2010; 82: 1170-1179
17 Saha S, Graessler J, Bornstein SR, Schwarz PE, Kopprasch S. Stimulation of phagocyte adhesion to endothelial cells by modified VLDL and HDL requires scavenger receptor BI. Mol Cell Biochem 2013; 383: 21-28
18 Li J, Feltzer RE, Dawson KL, Hudson EA, Clark BJ. Janus kinase 2 and calcium are required for angiotensin II-dependent activation of ster- oidogenic acute regulatory protein transcription in H295R human adrenocortical cells. J Biol Chem 2003; 278: 52355-52362
19 Richards JS. New signaling pathways for hormones and cyclic adeno- sine 3’,5’-monophosphate action in endocrine cells. Mol Endocrinol 2001; 15: 209-218
20 Schmitt JM, Stork PJ. Galpha and Gbeta gamma require distinct Src- dependent pathways to activate Rap1 and Ras. J Biol Chem 2002; 277: 43024-43032
21 Sattar N, Gaw A, Scherbakova O, Ford I, O’Reilly DS, Haffner SM, Isles C, Macfarlane PW, Packard CJ, Cobbe SM, Shepherd J. Metabolic syndrome with and without C-reactive protein as a predictor of coronary heart disease and diabetes in the West of Scotland Coronary Prevention Study. Circulation 2003; 108: 414-419
22 Younis N, Charlton-Menys V, Sharma R, Soran H, Durrington PN. Glyca- tion of LDL in non-diabetic people: Small dense LDL is preferentially glycated both in vivo and in vitro. Atherosclerosis 2009; 202: 162-168
23 Lam MC, Tan KC, Lam KS. Glycoxidized low-density lipoprotein regu- lates the expression of scavenger receptors in THP-1 macrophages. Atherosclerosis 2004; 177: 313-320
24 Braschi S, Geoffrion M, Nguyen A, Gaudreau Y, Milne RW. The expres- sion of apolipoprotein B epitopes is normal in LDL of diabetic and end-stage renal disease patients. Diabetologia 2006; 49: 1394-1401
25 Saha S, Bornstein SR, Graessler J, Kopprasch S. Very-low-density lipo- protein mediates transcriptional regulation of aldosterone synthase in human adrenocortical cells through multiple signaling pathways. Cell Tissue Res 2012; 348: 71-80
26 Yusuf S, Sleight P, Pogue J, Bosch J, Davies R, Dagenais G. Effects of an angiotensin-converting-enzyme inhibitor, ramipril, on cardiovascular events in high-risk patients. The Heart Outcomes Prevention Evalua- tion Study Investigators. N Engl J Med 2000; 342: 145-153
Downloaded by: University of Pittsburgh. Copyrighted material.