Crosstalk Between Glycoxidative Modification of Low- Density Lipoprotein, Angiotensin II-Sensitization, and Adrenocortical Aldosterone Release

Authors S. Saha, S. R. Bornstein, J. Graessler, S. Kopprasch

Affiliation

Department of Internal Medicine 3, Carl Gustav Carus Medical School, Technische Universität Dresden, Dresden, Germany

Key words

@ low-density lipoprotein

· glycoxidative lipoprotein modification

aldosterone

· Janus kinase

· protein kinase A

Abstract

Low-density lipoprotein (LDL) is considered to be a risk factor for atherosclerosis. In the presence of hyperglycemia, LDL undergoes glycoxidative modification and this glycoxidized (glycox) LDL promotes atherosclerosis in type 2 diabetic (T2D) individuals. Moreover, because of its cholesterol content, LDL contributes to aldosterone biosyn- thesis, which is modulated by angiotensin II (AngII) and has been implicated in cardiovascular complications of T2D. However, the molecular mechanism of the crosstalk between glycoxLDL, AngII, and aldosterone has not been explained clearly. Therefore, this study has been aimed to investigate the impact of in vitro modified gly- coxLDL on aldosterone release in an AngII-sensi- tized adrenocortical carcinoma cell line (NCI H295R). Native LDL (natLDL), isolated from healthy volunteers by sequential density gradi- ent ultracentrifugation, was subjected to D-glu- cose (200 mmol/l), for glycoxidative modification,

at 37℃ for 6 days. The AngII-sensitized H295R cells were treated with natLDL and glycoxLDL for 24h and the supernatant was used for aldoster- one measurement. The treated cells were utilized for protein isolation and mRNA quantification. Compared to natLDL, glycoxLDL produced a sig- nificantly greater effect on aldosterone release from AngII-sensitized cells. The treatment with specific pharmacological inhibitors suggests that modified LDL recruits ERK1/2 and janus kinase-2 for transcriptional regulation of aldosterone syn- thase. Moreover, glycoxLDL modulates aldoster- one release via cAMP-dependent protein kinase A (PKA) pathway. However, glycoxLDL induces ERK phosphorylation independent of PKA activa- tion and this novel mechanism could be targeted for therapeutic trials. In conclusion, this in vitro study emphasizes a possible causal relationship between LDL glycoxidative modification, AngII- sensitization, and adrenocortical steroid hor- mone release.

Downloaded by: University of Pittsburgh. Copyrighted material.

received 23.06.2014 accepted 28.10.2014

Bibliography

DOI http://dx.doi.org/ 10.1055/s-0034-1395568 Published online: January 20, 2015 Horm Metab Res 2015; 47: 855-860 @ Georg Thieme Verlag KG Stuttgart . New York ISSN 0018-5043

Correspondence

Dr. S. Kopprasch Pathological Biochemistry Department of Internal Medicine 3 Technische Universität Dresden Carl Gustav Carus Medical School Fetscherstraße 74 01307 Dresden Germany Tel .: +49/351/4584 523 Fax: +49/351/4585 330

Steffi.Kopprasch@uniklinikum- dresden.de

Introduction

The principal mineralocorticoid, aldosterone, is synthesized in the zona glomerulosa of adrenal cortex utilizing the common precursor, choles- terol, which is primarily derived from circulating lipoproteins such as high-density lipoproteins (HDL) and low-density lipoproteins (LDL) [1]. In humans, LDL is the major lipoprotein carrying cholesterol, and therefore, LDL may primarily contribute to cholesterol supply for steroidogen- esis [2]. Aldosterone is implicated in the induc- tion of structural and functional alterations in the heart, kidney, and blood vessels leading to the development of myocardial fibrosis, nephro- sclerosis, and vascular inflammation [3]. In addi- tion to circulating lipoproteins, aldosterone biosynthesis is also modulated by the vasocon-

strictor angiotensin II (AngII). Moreover, the overactivity of the renin-angiotensin-aldoster- one system (RAAS) has been causally associated with type 2 diabetis mellitus (T2D) and its meta- bolic complications [4]. In the presence of hyper- glycemia, a characteristic feature of T2D, LDL undergoes glycoxidative modification and thus eventually forms advanced glycation end prod- ucts (AGE) such as Nº-(carboxymethyl)lysine (CML) and Ne-(carboxyethyl)lysine (CEL) [5] resulting in increased incidence of atherosclero- sis. Furthermore, enhanced glycoxidation of cir- culating LDL has also been demonstrated in impaired glucose tolerance individuals [6].

Very recently, we have shown that glycoxida- tively modified HDL augments steroidogenesis in AngII-sensitized adrenocortical cells [7]. We have also shown that in the absence of AngII, glycox-

LDL is able to induce aldosterone release from adrenocortical cells [8]. It has also been documented by our group that the degree of LDL oxidation is inversely related to the adrenocortical aldosterone release [9] and thus, the heavily oxidized LDL had the lowest stimulatory effects. Moreover, the in vivo glycoxida- tive modification of LDL has also been demonstrated to have a lesser stimulatory effect on steroid hormone release than very low-density lipoprotein (VLDL) [10]. However, the molecular mechanism of the impact of in vitro LDL glycoxidative modifica- tion and AngII-sensitization on adrenocortical aldosterone release has yet to be determined. Therefore, the present study has been aimed to demonstrate the effect of in vitro modified glycoxidized LDL on AngII-sensitized NCI H295R cells with respect to aldosterone release and its underlying molecular mechanism.

Methods

Lipoprotein preparation, modification, and characterization

Native LDL (natLDL) was isolated from the blood, preserved in ethylenediaminetetraacetic acid (EDTA), of overnight fasting healthy volunteers by sequential density gradient ultracentrifu- gation as previously described [11]. Prior to glycoxidation, pro- tein content of LDL was equalized to 1.0g/l after dilution with phosphate buffered saline (PBS, pH=7.2) and dialyzed against 200 mmol/l D-glucose at 37℃ for 6 days resulting in the forma- tion of glycoxidized LDL (glycoxLDL). Finally, LDL was diluted to 0.6g/l protein. LDL protein and lipid modifications were rou- tinely assessed by determination of fluorescent products with an emission maximum at 430 nm when excited at 365 nm [12], by carbonyl formation according to Levine et al. [13] and by accumulation of thiobarbituric acid-reactive substances (TBARS) as described by Yagi [14], and as described previously [8].

Cell culture, treatment, and inhibition assay

Human adrenocortical cells (H295R) were cultured in DMEM (Sigma)/F12 (Invitrogen) medium, supplemented with insulin (66umol/l), hydrocortisone (10umol/l), 17B-estradiol (10umol/l), apo-transferrin (10µg/ml), sodium selenite (30umol/l), 2% FCS (Biochrom) along with penicillin (100 units), and streptomycin (100µg/ml) at 37℃ in a humidified atmosphere of 95% air with 5% CO2. Cells were seeded at a density of 70000 cells per cm2 and allowed to grow until 80% confluence. Cells were then incu- bated with AngII for 24h, followed by natLDL or glycoxLDL for the next 24h in serum-free media (SFM) in order to measure aldosterone released in the media. Subsequently the cells were utilized for protein extraction and RNA isolation. For investiga- tion of signaling mechanism, nonsensitized cells were treated with natLDL or glycoxLDL in the presence or absence of specific blockers for 24h in order to obtain exclusive effects of lipoproteins. All experiments were performed in duplicate in order to exclude the technical error during seeding and treatment of cells with lipoproteins and blockers. Specific pharmacological inhibitors, such as MEK inhibitor U0126 [1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadi- ene], p38 MAPKinase inhibitor SB203580 [4-(4-fluorophenyl)- 2-(4-methylsulfinylphenyl)-5-(4-pyridyl)-1H-imidazole · HCl], protein kinase C (PKC) inhibitor bis-indolylmaleimide I {2-[1-(3-dimethylaminopropyl)-1H-indol-3-yl]-3-(1H-indol-

3-yl) maleimide. HCI}, and Janus kinase-2 inhibitorAG490 (N-benzyl-3,4-dihydroxy-a-cyanocinnamide) were obtained from Calbiochem (Darmstadt, Germany). Following the treat- ment of cells with inhibitors, the viability of the cells was assessed by trypan blue viability test. This test showed that 85-90% cells were viable, which ensures that the decreased release of aldosterone was due to the effect of the inhibitors and not due to the decreased number of cells. In order to exclude the possibility of nonspecific effect of inhibitors, cells were treated only in the presence or absence of specific inhibitors and AngII or Forsokolin had been used as positive control, wherever it was appropriate. In preliminary experiments, cells were treated with different concentrations of pharmacological inhibitors in order to find out the appropriate dose so that the distinct pathways were sufficiently blocked.

Aldosterone measurement

Aldosterone release in cell culture medium was quantified in duplicate by radioimmunoassay (RIA) using Diagnostic Systems Laboratories kit.

Western blotting analysis

Protein concentration of the whole cell-lysates of H295R was quantified by bicinchoninic acid (BCA)™ protein assay kit (Pierce, USA). The denatured proteins were resolved electropho- retically [15] and the separated protein was then transferred onto a polyvinylidene difluoride membrane (Roti-PVDF). The membranes were probed overnight with antibody for specific protein phospho-extracellular signal regulated kinases (PERK1/2), (1:1 000, Cell Signaling Technologies, Germany). Nor- malization of protein loading was assessed using ß-actin anti- body (1:1000, Cell Signaling) as a control. The protein was detected by chemiluminescence using Supersignal West Pico Chemiluminescent substrate kit (Pierce) and densitometric analysis was carried out utilizing Genetool analysis software (GeneGenome; Syngene, UK).

RNA isolation and quantitative real-time PCR

After specific treatment with LDL and pharmacological inhibi- tors, H295R cells were utilized for RNA isolation using High Pure RNA Isolation kit (Roche). cDNA was prepared from total RNA by reverse transcription with M-MLV Reverse Transcriptase (Invitrogen) and real-time PCR was performed by Light Cycler 480 SYBR Green I Master kit (Roche). Primers used for amplifica- tion of the specific segments of respective cDNA are listed in . Table 1. Differences in gene expression, expressed as fold of control, were calculated using the 2-Act method where human B-actin was used as housekeeping gene.

Statistics

Comparison between 2 groups was carried out by Student’s t-test. Kolmogorov-Smirnov test was used to validate normal distribution of all data. A p-value less than 0.05 was considered to be statistically significant. All data are presented as mean ± standard error of mean (SEM).

Table 1 Primers used for real-time PCR.
hß-actin-FCCAACCGCGAGAAGATGA
hß-actin-RCCAGAGGCGTACAGGGATAG
hCyp11B2-FCCTGTTGAAGGCGGAACTGTCACTA
hCyp11B2-RAAAGAGCGTCATCAGCAAGGGAAAC

Results

As described previously [8], exposure of LDL to high glucose lev- els was accompanied by a mild elevation of fluorescence prod- ucts and protein carbonyl content. TBARS levels were significantly elevated (almost 5-fold) in glycoxLDL preparations.

GlycoxLDL promotes substantial increase in aldosterone release from AngII-sensitized H295R cells In order to observe the effect of LDL on sensitized cells, H295R cells were pre-incubated with AngII (100 nmol/l) for 24h. The supernatant was discarded and these cells were subsequently incubated with 100µg/ml natLDL or glycoxLDL for the next 24h. The aldosterone determination by RIA revealed that native and glycoxidized LDL induced significant increase in aldosterone release in both AngII-sensitized and nonsensitized H295R cells. In comparison with native LDL, glycoxLDL produced a 2-fold higher effect in AngII-sensitized cells (· Fig. 1).

Modified LDL recruits ERK1/2 for transcriptional regulation of aldosterone synthase

In our previous study [8] we have shown that glycoxLDL involves ERK1/2 for adrenocortical aldosterone release. In order to inves- tigate the role of MAP kinase in transcriptional regulation of aldosterone synthase, H295R cells were treated with all indi- cated forms of LDL with or without U0126 (10umol/l), the inhib- itor of ERK upstream kinase MEK, for 24h. The whole cell lysates were used for quantification of Cyp11B2 mRNA abundance by real-time PCR. As shown in · Fig. 2a, U0126 caused an impair- ment of Cyp11B2 mRNA levels in response to native and glycox- idized LDL, indicating the involvement of ERK1/2 at the transcriptional regulation of LDL-mediated aldosterone secre- tion. Simultaneous immunoblot analysis (· Fig. 2b) and subse- quent densitometric analysis ( Fig. 2c) reveal that treatment with U0126 caused nearly complete inhibition of LDL-induced ERK1/2 phosphorylation.

Fig. 1 Effect of native and glycoxidized LDL on aldosterone release from angiotensin II (AngII)-sensitized and nonsensitized NCI-H295R cells. In order to prepare the AngII-sensitized cells, H295R cells were pretreated with AngII (100nmol/l) for 24h. Then supernatant was decanted, both sensitized, and nonsensitized cells were incubated with 100 µg/ml of na- tive and glycoxLDL or vehicle (PBS) for the next 24h and supernatant was collected to measure aldosterone release by RIA. Data are means ± SEM of 5 different experiments, performed in duplicate with 3 different LDL preparations. **p<0.01, ***p<0.001, compared between AngII- sensitized and nonsensitized cells, §p<0.05, compared between native and modified LDL. C: Control; LDL: Low-density lipoprotein; nat: Native; glycox: Glycoxidized.

6000

Aldosterone release (pmol/l)

§


5000

with out Angll

with Angll

4000

3000

**

2000

1000

0

C

natLDL

glycoxLDL

LDL involves cAMP-dependent protein kinase A (PKA) for modulation of adrenocortical hormone release

In order to investigate the upstream regulator of MAP kinases the cells were treated with LDL in presence or absence of PKA inhibitor H89 (10umol/l) and protein kinase C (PKC) inhibitor bis-indolylmaleimide (BIM, 2umol/l) for 24h and the condi- tioned media was used for aldosterone measurement. BIM pro- duced significant inhibitory effect only on natLDL-mediated aldosterone release (· Fig. 3a) whereas PKA inhibitor H89 sig- nificantly reduced both native and modified forms of LDL-medi- ated adrenocortical steroidogenesis ( Fig. 3b). This indicates that the action of glycoxLDL is dependent only on PKA activation and natLDL involves both PKA and PKC for steroid hormone release in adrenocortical cells.

H89 is a nonspecific inhibitor of PKA [16]. In order to confirm the observation made with H89 and to evaluate the specific involve-

Fig. 2 Native and modified LDL-mediated aldosterone release involves ERK signaling pathway. H295R cells were treated with different forms of LDL (100 µg/ml) in the presence or absence of U0126 for 24h. a Whole cell lysates were used for real-time PCR to observe the effect of ERK up- stream kinase MEK inhibitor U0126 (10 µmol/l) on Cyp11B2 mRNA level. Data are mean ± SEM of 4 different experiments performed in duplicate with 3 different LDL preparations. * p<0.05, NS: Not significant, as com- pared to respective values in absence of inhibitor. b Representative im- munoblot of LDL-induced ERK1/2 phosphorylation with or without U0126 (10μmol/l), H89 (10μmol/l) and AG490 (50μmol/l) following treatment for 10 min and after stripping, the membrane was incubated with ß-actin antibody in order to normalize the protein loading. This is the representa- tive of 3 independent experiments with 2 different LDL preparations, showing similar tendency. LDL: Low-density lipoprotein; nat: Native; glycox: Glycoxidized; ERK: Extracellular signal-regulated kinase. c Densitometric values of ERK1/2 phosphorylation. Data are means ± SEM of 3 independent experiments.

a

14

without U0126

12

with U0126

CYP11B2 mRNA (fold of control)

I

10

glycoxLDL + + Without Blocker 12 With U0126 With AG490 Downloaded by: University of Pittsburgh. Copyrighted material. — — —

*

8

*

6

4

NS

2

0

C

natLDL

b

PERK1/2

B-Actin

natLDL

+

+

+

glycoxLDL

+

+

+

U0126

+

+

AG490

+

+

H89

+

c

160

ERK1/2 phosphorylation (% of natLDL without blocker)

140

120

100

80

60

40

= With H89

20

0

natLDL

glycoxLDL

Fig. 3 Effect of various inhibitors on LDL-induced hormone release. H295R cells were incubated with forskolin (FSK, 20 umol/l) or AngIl (angiotensin II) or native and glycoxidized LDL (100 µg/ml) in presence or absence of a protein kinase C inhibitor bis-indolylmaleimide I (BIM, 2 umol/l), b protein kinase A inhibitor, H89 (10 µmol/l), and c cAMP analogue, Rp-CAMP (1 mmol/l), for 24h and the conditioned medium was collected for aldosterone measurement. Data are mean ± SEM of 3 different experiments performed in duplicate with 2 different LDL preparations. * p<0.05, ** p<0.01, *** p<0.001. NS: Not significant, as compared to respective values in the absence of inhibitor; C: Control cells; LDL: Low-density lipoprotein; nat: Native; glycox: Glycoxidized. FSK and AngII, presented as positive control.

a

600

Aldosterone release (pmol/l)

Without BIM

500

T

With BIM

Y

*

NS

400

300

200

NS

**

100

I

T

0

C

Angll

natLDL

glycoxLDL

Aldosterone release (pmol/l)

700

600

Without H89

T

**

I

500

With H89

I

*

400

300

200

*

100

7

NS

0

C

FSK

natLDL

glycoxLDL

Aldosterone release (pmol/l) ^

800

700

T

600

Without RpcAMP

T

500

With RpcAMP

**


400

T

300

200

100

NS

0

c

natLDL

glycoxLDL

ment of cyclic adenosine monophosphate (cAMP) in LDL-mediated aldosterone release, the H295R cells were treated with or without CAMP analogue Rp-cAMP (1 mmol/l) in the presence of native and glycoxLDL for 24h and aldosterone release was measured in super- natants. . Fig. 3c reveals that the Rp-cAMP interfered with aldosterone release in a similar way like PKA inhibitor H89.

LDL recruits Janus kinase-2 (Jak-2) for steroidogenesis Previous studies revealed that glycoxidized HDL requires Janus kinase for adrenocortical steroidogenesis [7] and macrophage adhesion to endothelial cells [17]. In order to investigate the involvement of Jak-2 in LDL-mediated mineralocorticoid secre- tion, cells were treated with LDL with or without Jak-2 inhibitor AG490 (50umol/l) for 24h and the conditioned medium was used for aldosterone determination. . Fig. 4a, b show that AG490 caused significant inhibition of both native and modified LDL-mediated aldosterone release and Cyp11B2 mRNA level indicating the involvement of Jak-2 for steroid hormone release in adrenocortical cells.

Fig. 4 LDL requires Jak-2 activation for adrenocortical steroidogen- esis. H295R cells were incubated with native and modified forms of LDL in presence or absence of Jak-2 inhibitor AG490 (50 umol/l) for 24h. Subsequently a supernatants were used for aldosterone measurement and b cell lysates were utilized for Cyp11B2 mRNA quantification. Data are mean ± SEM of 4 different experiments performed in duplicate with 3 different LDL preparations. c Schematic representation of the probable signaling pathways regulated by glycoxLDL in mediating adrenal aldos- terone release. * p<0.05, ** p<0.01, NS: Not significant, as compared to respective values in absence of inhibitor; C: Control; glycox: Glycoxidized; LDL: Low-density lipoprotein; Jak-2: Janus kinase-2; CYP11B2: Aldosterone synthase; ERK: Extracellular signal-regulated kinase; PKA: Protein kinase A ;?: Some unknown factor may be involved in Jak-2 mediated aldosterone release. (Color figure available online only).

a

700

Aldosterone release (pmol/l)

600

T

without AG490

500

with AG490

400

300

200

**

**

100

*

NS

I

0

C

Angli

natLDL

glycoxLDL

CYP11B2 mRNA (fold of control)

14

12

without AG490

10

with AG490

8

6

*

*

4

2

NS

0

C

natLDL

glycoxLDL

c

glycox LDL

PKA

Jak-2

ERK 1/2

?

mRNA transcription

Aldosterone release

MAP kinase is employed as a potential downstream target of Jak-2 but not that of PKA in response to native and modified LDL-mediated ERK phosphorylation It has been documented that Jak-2 can activate both STAT, as well as MAP kinase, as its downstream effectors [18]. Similarly, PKA also can recruit ERK1/2 as its downstream modulator [19,20]. Hence, in order to study the involvement of ERK1/2 in

Downloaded by: University of Pittsburgh. Copyrighted material.

Jak-2, as well as PKA-dependent pathways, cells were treated with native and glycoxLDL (100 µg/ml) in the presence or absence of Jak-2 inhibitor AG490 (50umol/l) or PKA inhibitor H89 (10umol/l) for a period of 10 min. Then, the whole cell lysates were immunoblotted and probed for pERK protein. · Fig. 2b, c (densitometric analysis) demonstrate significant impairment of ERK phosphorylation by AG490, while H89 could not produce inhibition. This implies that glycoxLDL-mediated PKA-dependent steroidogenesis does not involve ERK phosphorylation.

Discussion

Metabolic syndrome is a frequent antecedent of T2D whose presence increases the risk of development of cardiovascular, cerebrovascular, and peripheral vascular diseases [21]. Diabetic dyslipidemia includes the appearance of small dense LDL parti- cles that are more susceptible to glycoxidative modification [22] and therefore, enhance their atherogenic potential. Various studies suggest that glycoxLDL promotes the development of atherosclerotic lesions in diabetic individuals through inhibition of endothelium-dependent vasodilation, stimulation of super- oxide radical release and regulation of the expression of scaven- ger receptors in macrophages [23]. However, the molecular mechanisms of the biological effects of glycoxLDL are not entirely identified. Therefore, the present study has been designed to investigate a possible crosstalk between glycoxida- tion of LDL, AngII-sensitization, and aldosterone release, which could mediate cardiovascular complications in T2D.

The present study shows that the glycoxLDL-induced metabolic effects were similar to effects of natLDL. However, in AngII-sen- sitized cells glycoxLDL produced significantly more aldosterone than natLDL. On the contrary, in vivo modified LDL isolated from subjects with impaired glucose tolerance could not produce greater effects in AngII-sensitized adrenocortical carcinoma cell line compared to LDL isolated from individuals with normal glu- cose tolerance [10]. This discrepancy may be due to the fact that in vitro LDL modification in the presence of high glucose concen- trations may not always mimic the complex in vivo process of glycoxidation [24]. Moreover, in this study in vitro modification was performed in the presence of 200 mM glucose, which bio- chemically mimics overt diabetes mellitus rather than a predia- betic condition. In diabetic conditions, biochemical modification of lipoproteins is not only characterized by glycation but also by oxidation. In a previous study, we showed that in vitro oxida- tively modified LDL (oxLDL) evoked a lesser increase in adreno- cortical aldosterone release compared to natLDL [9]. However, the pretreatment with oxLDL enhanced sensitivity of cells to AngII [9] explaining the augmented adrenocortical steroid hor- mone release in metabolic disorders.

The susceptibility of LDL-induced aldosterone release to the spe- cific pharmacological inhibitors H89, U0126 and AG490 deci- phers a role of PKA, ERK1/2, and Jak-2 in the glycoxLDL-mediated steroidogenesis. However, the partial inhibition of ERK phos- phorylation by AG490 and lack of inhibition by H89 implies that Jak-2 employs ERK1/2 as its downstream effector but PKA works independent of ERK activation. Moreover, this partial inhibition by AG490 also indicates that LDL recruits not only ERK1/2 as a downstream effector of Jak-2 but also some other downstream effectors such as STAT3. The observed data provide evidence for the existence of a novel mode of aldosterone regulation via CAMP-PKA dependent and Jak-2-ERK1/2 dependent pathways. A

similar signaling mechanism was also demonstrated in very low density lipoprotein (VLDL)-mediated aldosterone release [25]. The putative signaling cascade regulated by glycoxidatively modified lipoproteins is presented as a schematic diagram in · Fig. 4c. The treatment with specific pharmacological inhibi- tors infers that all 3 lipoproteins (glycoxHDL, glycoxLDL, and gly- coxVLDL) recruit ERK1/2 for adrenortical steroidogenesis. Protein kinase C (PKC), as an upstream regulator for HDL-medi- ated aldosterone release, requires ERK phosphorylation [7] whereas, for glycoxLDL- and glycoxVLDL-mediated steroid hor- mone release, PKA works independent of ERK activation [25]. Therefore, our inhibitor study emphasizes the speculation of ERK1/2 blocker as a novel mode of therapy for aldosterone- mediated various complications in diabetes mellitus while unaf- fected PKA-dependent pathway would maintain the daily requirement of aldosterone for cardiovascular homeostasis.

In summary, the glycoxidative modification of LDL plays a cru- cial role in augmenting aldosterone release from AngII-sensi- tized H295R cells via a novel mode of signaling mechanisms where PKA works independent of ERK phosphorylation while Jak-2 signaling partially depends on ERK activation for glycox- LDL-stimulated adrenocortical aldosterone release. Further- more, LDL-mediated enhanced aldosterone release from AngII-sensitized cells once again supports the possible impor- tance of RAAS modulation in reducing morbidity and mortality in diabetic individuals [26].

Acknowledgements

The authors would like to thank Martina Kohl, Sigrid Nitzsche, and Eva Schubert for their excellent technical support and Ryan Ban for careful reading of the manuscript.

Conflict of Interest

The authors declare that they have no conflicts of interest that could be perceived as prejudicing the impartiality of the research reported.

References

1 Azhar S, Leers-Sucheta S, Reaven E. Cholesterol uptake in adrenal and gonadal tissues: the SR-BI and ‘selective’ pathway connection. Front Biosci 2003; 8: s998-s1029

2 Carr BR, Simpson ER. Lipoprotein utilization and cholesterol synthesis by the human fetal adrenal gland. Endocr Rev 1981; 2: 306-326

3 Krug AW, Ehrhart-Bornstein M. Aldosterone and metabolic syndrome: is increased aldosterone in metabolic syndrome patients an additional risk factor? Hypertension 2008; 51: 1252-1258

4 Henriksen EJ. Improvement of insulin sensitivity by antagonism of the renin-angiotensin system. Am J Physiol Regul Integrat Comparat Physiol 2007; 293: R974-R980

5 Veiraiah A. Hyperglycemia, lipoprotein glycation, and vascular disease. Angiology 2005; 56: 431-438

6 Graessler J, Pietzsch J, Westendorf T, Julius U, Bornstein SR, Kopprasch S. Glycoxidised LDL isolated from subjects with impaired glucose tol- erance increases CD36 and peroxisome proliferator-activator recep- tor gamma gene expression in macrophages. Diabetologia 2007; 50: 1080-1088

7 Saha S, Graessler J, Schwarz PE, Goettsch C, Bornstein SR, Kopprasch S. Modified high-density lipoprotein modulates aldosterone release through scavenger receptors via extra cellular signal-regulated kinase and Janus kinase-dependent pathways. Mol Cell Biochem 2012; 366: 1-10

8 Saha S, Willenberg HS, Bornstein SR, Graessler J, Kopprasch S. Diabetic lipoproteins and adrenal aldosterone synthesis - a possible patho- physiological link? Horm Metab Res 2012; 44: 239-244

9 Ansurudeen I, Pietzsch J, Graessler J, Ehrhart-Bornstein M, Saha S, Born- stein SR, Kopprasch S. Modulation of adrenal aldosterone release by oxidative modification of low-density lipoprotein. Am J Hypertens 2010; 23: 1061-1068

10 Saha S, Schwarz PE, Bergmann S, Bornstein SR, Graessler J, Kopprasch S. Circulating very-low-density lipoprotein from subjects with impaired glucose tolerance accelerates adrenocortical cortisol and aldosterone synthesis. Horm Metab Res 2013; 45: 169-172

11 Pietzsch J, Subat S, Nitzsche S, Leonhardt W, Schentke KU, Hanefeld M. Very fast ultracentrifugation of serum lipoproteins: influence on lipoprotein separation and composition. Biochim Biophys Acta 1995; 1254: 77-88

12 Maeba R, Shimasaki H, Ueta N. Conformational changes in oxidized LDL recognized by mouse peritoneal macrophages. Biochim Biophys Acta 1994; 1215: 79-86

13 Levine RL, Garland D, Oliver CN, Amici A, Climent I, Lenz AG, Ahn BW, Shaltiel S, Stadtman ER. Determination of carbonyl content in oxida- tively modified proteins. Meth Enzymol 1990; 186: 464-478

14 Yagi K. A simple fluorometric assay for lipoperoxide in blood plasma. Biochem Med 1976; 15: 212-216

15 Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227: 680-685

16 Garrel G, Simon V, Thieulant ML, Cayla X, Garcia A, Counis R, Cohen- Tannoudji J. Sustained gonadotropin-releasing hormone stimulation mobilizes the cAMP/PKA pathway to induce nitric oxide synthase type 1 expression in rat pituitary cells in vitro and in vivo at proestrus. Biol Reprod 2010; 82: 1170-1179

17 Saha S, Graessler J, Bornstein SR, Schwarz PE, Kopprasch S. Stimulation of phagocyte adhesion to endothelial cells by modified VLDL and HDL requires scavenger receptor BI. Mol Cell Biochem 2013; 383: 21-28

18 Li J, Feltzer RE, Dawson KL, Hudson EA, Clark BJ. Janus kinase 2 and calcium are required for angiotensin II-dependent activation of ster- oidogenic acute regulatory protein transcription in H295R human adrenocortical cells. J Biol Chem 2003; 278: 52355-52362

19 Richards JS. New signaling pathways for hormones and cyclic adeno- sine 3’,5’-monophosphate action in endocrine cells. Mol Endocrinol 2001; 15: 209-218

20 Schmitt JM, Stork PJ. Galpha and Gbeta gamma require distinct Src- dependent pathways to activate Rap1 and Ras. J Biol Chem 2002; 277: 43024-43032

21 Sattar N, Gaw A, Scherbakova O, Ford I, O’Reilly DS, Haffner SM, Isles C, Macfarlane PW, Packard CJ, Cobbe SM, Shepherd J. Metabolic syndrome with and without C-reactive protein as a predictor of coronary heart disease and diabetes in the West of Scotland Coronary Prevention Study. Circulation 2003; 108: 414-419

22 Younis N, Charlton-Menys V, Sharma R, Soran H, Durrington PN. Glyca- tion of LDL in non-diabetic people: Small dense LDL is preferentially glycated both in vivo and in vitro. Atherosclerosis 2009; 202: 162-168

23 Lam MC, Tan KC, Lam KS. Glycoxidized low-density lipoprotein regu- lates the expression of scavenger receptors in THP-1 macrophages. Atherosclerosis 2004; 177: 313-320

24 Braschi S, Geoffrion M, Nguyen A, Gaudreau Y, Milne RW. The expres- sion of apolipoprotein B epitopes is normal in LDL of diabetic and end-stage renal disease patients. Diabetologia 2006; 49: 1394-1401

25 Saha S, Bornstein SR, Graessler J, Kopprasch S. Very-low-density lipo- protein mediates transcriptional regulation of aldosterone synthase in human adrenocortical cells through multiple signaling pathways. Cell Tissue Res 2012; 348: 71-80

26 Yusuf S, Sleight P, Pogue J, Bosch J, Davies R, Dagenais G. Effects of an angiotensin-converting-enzyme inhibitor, ramipril, on cardiovascular events in high-risk patients. The Heart Outcomes Prevention Evalua- tion Study Investigators. N Engl J Med 2000; 342: 145-153

Downloaded by: University of Pittsburgh. Copyrighted material.