ELSEVIER
Molecular and Cellular Endocrinology
journal homepage: www.elsevier.com/locate/mce
Molde lar and Cellular Endocrinology
·
Activin-Bc modulates gonadal, but not adrenal tumorigenesis in the inhibin deficient mice
CrossMark
Francesco Elia Marino a,*, Gail Risbridger b, Elspeth Gold a, **
a Department of Anatomy, University of Otago, Dunedin, New Zealand
b Department of Anatomy and Developmental Biology, Monash University, Clayton, Victoria
ARTICLE INFO
Article history: Received 20 January 2015 Received in revised form 15 March 2015 Accepted 7 April 2015 Available online 11 April 2015
Keywords: Inhibin Testis Ovaries Gonadectomy Adrenal Tumor
ABSTRACT
Activins and inhibins are involved in the regulation of several biological processes, including reproduc- tion, development and fertility. Deregulation of the inhibin/activin signaling pathway has been implicated in the progression of reproductive and adrenal cancers. Deletion of the inhibin o-subunit results in up- regulation of the circulating levels of activins and this leads to the development of sex-cord stromal tumors followed by a cancer associated-cachexia in mice. When gonadectomy is performed, development of ad- renocortical carcinomas is observed. We previously showed that overexpression of activin-Bc modulates the development of sex-cord stromal tumors and reduces cancer-cachexia in the inhibin-deficient mice by antagonizing the activin signaling pathway. The adrenal cortex and gonads share in common a large subset of genes, consistent with their common embryonic lineage. Additionally, it has been shown that adrenocortical carcinomas adopt an altered cellular identity resembling the ovary. Therefore, a study to assess the impact of overexpression of activin-Bc on the onset of adrenocortical carcinoma in gonadec- tomized inhibin-deficient mice was warranted. Within the current study we evaluated markers of apoptosis, proliferation, tumor burden, survival analysis and serum levels of activin-A in gonadectomized mice versus sham operated controls. Results showed that overexpression of activin-Bc modulated the development of reproductive tumors but had no effect on adrenal tumorigenesis. Our data reinforces the importance of activin-Bc in reproductive biology and suggest that activin-Bc is a tumor modulator with gonadal specificity. @ 2015 Elsevier Ireland Ltd. All rights reserved.
1. Introduction
Adrenal masses are one of the most common endocrine tumors diagnosed. They are often incidentally discovered and known as “adrenal incidentaloma”. The clinical presentation of the adrenal incidentaloma is usually silent, and the rate of detection has in- creased significantly during the last three decades due to the widespread use of modern imaging techniques (Beuschlein et al., 2004). In the absence of a malignancy of non-adrenal origin, the majority of adrenal incidentaloma are benign with a prevalence at least 3% in a population over the age of 50 years (Grumbach et al., 2003). In contrast, the aggressive form of adrenocortical cancer is known as adrenocortical carcinomas.
Adrenocortical carcinomas (AACs) represent a rare but highly ma- lignant endocrine tumor with a worldwide incidence of approximately 2 new cases per million person per year with an heterogeneous
presentation and generally poor prognosis (Dackiw et al., 2001; Lipsett et al., 1963). When surgery is performed the rate of malignant ad- renocortical carcinoma in adrenal incidentaloma on which surgery is performed is 12% (Mantero et al., 2000). The therapeutic options for most ACCs are limited, and response rates are generally low (Bukowski et al., 1993). Therefore, the development of better thera- pies is a continuing challenge.
Inhibin and activin, two members of the TGF-ß superfamily, have been shown to have a crucial role in the regulation of gonadal and adrenal physiology. Inhibin and activin were originally discovered and classified as hormonal factors two decades ago. Their func- tion was originally attributed to the reproductive axis only, but subsequent studies revealed they were widely distributed anatomi- cally with important physiological functions not only limited to the reproduction. Several studies showed the presence of inhibin and activin in different human tissues of both endocrine and non- endocrine organs (Ling et al., 1985; Miyamoto et al., 1985; Rivier et al., 1985; Robertson et al., 1985). Inhibins are dimers of an a subunit and either a BA or BB subunit (a .: BA and a:BB), whereas activins are homodimers activin-A (BA:BA), activin-B (BB:BB) or heterodimers activin-AB (BA:BB) of the BA or BB subunits. After their initial dis- covery, another subset of activin-ß subunits (Bc, BD, BE) was identified, based on homology to the BA and BB subunits (Lau et al., 2000). The Bc subunit dimerizes with itself and the BA and BB subunits in vitro
* Corresponding author. Department of Anatomy, University of Otago, PO Box 913, Dunedin 9054, New Zealand. Tel .: +64 3 479 5647; fax: +63 3 479 7254. E-mail address: francescoelia.marino@otagoanatomy.com (F.E. Marino).
** Corresponding author. Department of Anatomy, University of Otago, PO Box 913,
Dunedin 9054, New Zealand. Tel .: +64 3 479 5647; fax: +63 3 479 7254.
E-mail address: Elspeth.Gold@otago.ac.nz (E. Gold).
to form activin-C: (Bc Bc), activin-AC (BABc) and activin-BC (BB:Bc) (Mellor et al., 2000).
In humans, inhibin is specifically localized to the fetal zone of the developing adrenal cortex, and its expression has been dem- onstrated in virilizing tumors presumed to have arisen from the inner reticular zone of the adrenal gland but not in tumors of the fasciculata and glomerulosa origin (Arola et al., 2000; Beuschlein et al., 2003). Additionally, radio-labeled and expression studies of the inhibin/activin signaling pathway have demonstrated the pres- ence of activin receptors, binding proteins, and intracellular effectors in the adult and fetal adrenal. Thus, demonstrating that the adrenal cortex produces these molecules, and they represent important mo- lecular players essential for the regulation of adrenal homeostasis (Vanttinen et al., 2003; Woodruff et al., 1993).
The relevance of inhibin and activin in adrenocortical cell growth in mice was established by the observation of adrenal tumors de- veloped in gonadectomized inhibin-deficient mice (o .- KO). In fact, o .- KO mice develop sex-cord stromal tumors of testis and ovary fol- lowed by a severe cancer-associated cachexia phenotype leading to mortality in 12 and 17 weeks in males and females respectively (Matzuk et al., 1992). Gonadectomy in these animals increases life expectancy but adrenal tumors occur causing death at 33 and 37 weeks in male and females respectively (Matzuk et al., 1994).
The gonadectomy-induced adrenocortical neoplasm in the inhibin-deficient mice adopts a phenotype similar to the sex-cord stromal tumors (Looyenga and Hammer, 2006). Adrenal tumors in the a-KO mice originate from sub-capsular progenitor cells which, due to increased levels of gonadotropins caused by an unopposed activin signaling, express aberrant levels of the transcription factor GATA4 and other ovarian cell markers (Looyenga and Hammer, 2006). In the presence of ovarian and testicular tumors, the high levels of activin-A produced by these tumors prevent adrenal tumorigen- esis suppressing the x-zone proliferation through the induction of apoptosis in the adrenal gland (Beuschlein et al., 2003; Hofland and de Jong, 2012). Therefore, only upon gonadectomy adrenal tumors can be observed in the inhibin-deficient mice.
Our group previously showed that overexpression of activin-Bc reduces the progression of Sertoli and granulosa cell tumors, and reduces the cachexia-like syndrome in the inhibin-deficient mice increasing survival rates and antagonizing activin-A (Gold et al., 2013). These findings suggested that the activin-Bc subunit plays an important role in modulating gonadal tumorigenesis.
Due to the common embryonic origin of the adrenal cortex and gonads and the sex-cord stromal tumors like phenotype adopted by the adrenocortical carcinomas in the inhibin-deficient mice, a study to assess the impact of activin-Bc on the adrenal tumorigen- esis was warranted. Specifically, the current study was designed to determine the effect of activin-ßc on survival and adrenal tumori- genesis in gonadectomized o .- KO mice. Survival analysis, serum levels of activin-A, tumor burden, and marker of apoptosis and prolifer- ation were assessed. The protein expression levels of follistatin, activin receptor IIB and p-Smad2/Smad2 were also investigated to determine if activation of the activin/TGF-ß was present in adrenal tumors and if any perturbation at the receptor or activin’s antag- onist was present.
2. Material and methods
2.1. Experimental animals
All experiments were approved by the Animal Ethics Commit- tee of the University of Otago and conducted in accordance with the New Zealand code of practice in adherence with the NIH guide for the care and use of laboratory animals. All animals were housed under a 12:12-h light-dark cycle, food and water were available ad libitum. Mice on C57BL/6 background were originally purchased from
Jackson Laboratories (Bar Harbor, ME) and bred at the University of Otago. a-KO mice were kindly provided by Professor Martin Matzuk (Baylor College of Medicine Houston).
Human activin-Bc (under the control of a CMV promoter) - overexpressing mice (ActC++) were obtained from Monash Univer- sity, Australia (Gold et al., 2009). To obtain the o-KO/ActC++ mice, heterozygous a-KO mice were crossed with double heterozygous ActC++ mice (Gold et al., 2013). A competitive genomic PCR screen- ing strategy with specific primers was used to confirm positive progeny (Gold et al., 2009; Matzuk et al., 1992).
2.2. Surgical procedure
Excision of testes or ovaries (gonadectomy) or sham operation (exploratory surgery with no tissue excision) was performed on male and female mice aged 38 ± 5 days.
2.3. Mouse monitoring
Changes in body weight, tumor mass, BAR (bright, alert, respon- sive) score, general clinical signs (inactive, hunched posture, red eye/ nose discharges, pink staining of the neck, dehydration), behavioral signs of pain and water balance were monitored after surgery. Animals were sacrificed when one of the following humane end-points was observed: (1) weight loss of 10% or more over 24 hours; (2) weight loss of 20% or more plus one other clinical sign compared to the control group; (3) weight loss of 25% compared to the control group.
2.4. Tissue collection
Animals were anesthetized and serum was obtained by cardiac puncture. Animals were then euthanized by cervical dislocation. Tail biopsy was obtained and snap frozen to confirm genotype. The a-KO and o-KO/ActC++ mice were sacrificed when clinical manifesta- tion of any of the human end-points reported earlier was recorded. WT and ActC++ mice survived up to 30 weeks of age, 4-8 female and male mice were included in each group.
When animals were sacrificed, adrenals and gonads were dis- sected and wet-weight recorded. One adrenal or gonad was snap frozen in liquid nitrogen; the contralateral tissue was stored in Bouin’s solution for 4-6 hours and then washed and stored in 70% ethanol for 12-24 hours.
2.5. Histological analysis
Tissues were washed in 70% ethanol, embedded in Paraffin and sectioned at 5 um onto Superfrost Microscope Slides (Menzel-Glaser).
Tissues were sectioned into two halves through their trans- verse axis. The cut surface of each half was embedded and 30 serial sections were cut and mounted. Three slides spaced equally through the tissue were used for staining and/or stereological analysis (e.g. sections 1, 11 and 21 or sections 10, 20 and 30).
2.6. Hematoxylin and eosin staining
Immunohistochemistry was performed by de-waxing tissue sec- tions using xylene for 15 minutes, re-hydrated in alcohol (100%, 90%, 70%) before being immersed in water. Sections were then stained with hematoxylin for 1 minute, washed for 4 minutes under running tap water and stained with eosin for 30 s. Slides were dehydrated through graded alcohol (70, 90 and 100%), incubated in xylene then mounted with DPX mounting media and analyzed using the Olympus BX61 microscope and the Volocity software version 5.2.0.
Percent tumor was assessed based on the Cavalieri principle using point counting on 5-um sections spaced 50 um apart using 40x mag- nification for at least three sections per animal. Points landing on
tumor (hemorrhagic, necrotic foci or tissue with an abnormal mor- phology) were expressed as a percentage of the total points (Gold et al., 2013; McPherson et al., 2010).
2.7. Apoptag® and PCNA staining
Apoptosis was examined evaluating the DNA fragmentation by the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay (Gavrieli et al., 1992) using the ApopTag® Peroxi- dase In Situ Apoptosis Detection Kit (Millipore cat # S7100). Experiments were conducted according to the manufacturer’s in- structions with minor variations to the protocol as follows. Briefly, specimens were washed in 3 changes of xylene for 5 min each and re-hydrated in changes of absolute ethanol, 95% ethanol and 70% ethanol. Specimens were then washed in PBS for 5 minutes and in- cubated with 20 ul of equilibration buffer (Millipore cat # 90416) for 30 minutes. At this point slides were incubated for 1 hour at 37 ℃ with the terminal deoxynucleotidyl transferase (TdT) enzyme (Millipore cat # 90418) diluted in reaction buffer (Millipore cat # 90417) according to the manufacturer’s instructions. The reac- tion was blocked by putting the specimens in the working strength stop/wash (Millipore cat # 90418) buffer for 30 minutes at 37 ℃. After 1 wash in PBS for 5 minutes endogenous peroxidase was quenched by using the peroxidase-blocking solution (DAKO Real S2023) for 15 minutes at room temperature. After 2 washes in PBS for 5 minutes each slides were incubated with CAS block (Life Tech- nologies # 008120) for 20 minutes. Anti-digoxigenin (Millipore cat # 90420) was then applied for 30 minutes at room temperature followed by detection with the DAKO Real EnVision Detection System
(DAKO K5007). Slides were then mounted with DPX mountant for histology (Sigma # 06522) and used for microscopy analysis. Random fields were systematically selected using Volocity software version 5.2.0 (Counihan et al., 2011) and sampling was conducted using an unbiased counting frame. Frame counting was performed on sec- tions uniformly spaced throughout the tissue, 5-10 frames and 40x magnification, with an average of 500-1000 cells counted per section (Gold et al., 2005). Cells were quantified using Cell Counter plugin for Image] (Kurt De Vos, University of Sheffield, UK) (Makarev and Gorivodsky, 2014). Negative controls included reaction buffer only.
Proliferating cells were evaluated using proliferating cell nuclear antigen (PCNA) mouse monoclonal antibody (DAKO cat # M0879). Immunohistochemistry was performed after microwave antigen retrieval in 10 mM sodium citrate buffer pH 6.0 (1000 W for 14 minutes). After cooling, slides were washed three times in PBS, and endogenous peroxidase activity was quenched using peroxidase- blocking solution (DAKO Real S2023). Sections were treated with CAS blocking reagent (Invitrogen 00-8120). Primary antibody was added at a dilution 1:400 at 4 ℃ for 16 hours. Slides were then washed 3 times for 5 minutes each in PBS and incubated with DAKO Real EnVision Detection System (DAKO K5007), mounted with DPX and analyzed as described earlier. Negative controls included sec- ondary antibody only.
2.8. Activin-Bc subunit expression RT (reverse transcription)-PCR
To assess if activin-Bc was expressed in the adrenals total RNA was extracted as previously described (Marino et al., 2014) and PCR con- ducted as follows. Primers sequences (all 5’-3’) were designed using
A
B
150
150-
Tumor (%)
Tumor (%)
100
100-
50
50-
ns
ns
0
0
WT
ActC++
a-KO
a-KO/ActC++
WT
ActC++
a-KO
a-KO/ActC++
WT
ActC++
WT
ActC++
a-KO
a-KO/ActC++
a-KO
a-KO/ActC++
100 um
Primer-BLAST: activin-Bc, forward: CCTGCGGGTGTAGTTAGCTT, reverse: GCTGAGGATGGGTG; ß-actin, forward GCCTTCCTTCTTGGGTATGG; reverse: CAGCTCAGTAACAGTCCGCC; The PCR program was 94 ℃ for 5 min; 35 cycles of 30 s at 94 ℃, 30 s at 58 ℃ and 30 s at 72 ℃; 72 ℃ for 7 min. All PCR products were run on 1.5% (w/v) agarose gels.
2.9. Activin-A ELISA
Serum levels of Activin-A were assessed from 3 animals per group using the Quantikine ELISA from (R&D cat # DAC00B) according to the manufacturer’s instructions.
MALES
FEMALES
A
ns
B
ns
80-
100-
Tumor (%)
Tumor (%)
60-
80-
60-
40-
40-
20-
20-
0
WT
ActC++
a-KO
a-KO /ActC++
0
WT
ActC++
a-KO
a-KO /ActC++
C
ns
D
ns
**
0.20-
0.15-
Adrenal (g)
*
**
0.15-
Adrenal (g)
**
**
0.10-
0.10-
*
0.05-
0.05-
0.00
WT
ActC++
a-KO
a-KO /ActC++
0.00
WT
ActC++
a-KO
a-KO /ActC++
E
F
Survival rate (%)
100
Survival rate (%)
100
ns
50-
50-
*
0
0
10
20
30
0
0
10
20
30
Weeks
WT
Weeks
ActC++
a-KO
a-KO /ActC++
2.10. Western blotting
Frozen tissues from 3 animals per group were homogenized with the Tissue Lyser II (Qiagen Cat # 85300) for 5 minutes at 30 Hz in ice-cold RIPA buffer [150 mM NaCl, 1.0% IGEPAL® CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris pH 8.0 (Sigma-Aldrich Cat # R0278)] containing protease and phosphates inhibitor (Thermo Scientific cat # 78440) according to the manufacturer’s instruc- tions, and the whole homogenate was used for further analysis. Sample protein concentration was determined using the BCA Protein Assay Reagent KIT (Thermo Scientific cat # 23225) and equivalent amounts of protein from each sample (30 µg) were subjected to elec- trophoretic separation on 12% SDS-PAGE acrylamide gels in Tris- Glycine-SDS running. Following electrophoresis separation, proteins were transferred to a nitrocellulose membrane (GE Healthcare #10600003) in transfer buffer (250 mM Tris, 1.92M glycine, 10% meth- anol), blocked with Odyssey Blocking buffer (Li-Cor cat # 927-40000) for 1 h followed by an overnight incubation with primary antibody dissolved in Odyssey blocking buffer containing 0.2% Tween-20 (Sigma-Aldrich cat # P2287). Antibodies used were: activin recep- tor IIB (Abcam cat # 76940), follistatin (Santa Cruz Biotechnology cat # sc-30194), smad-2 (Abcam cat # 47083), p-smad-2 (Abcam cat # 53100), GAPDH (Abcam cat # 9484 and Abcam cat # 181602).
After an overnight incubation, blots were incubated with sec- ondary antibodies diluted in Odyssey Blocking Buffer for 1 hour at room temperature. Secondary antibodies used were: IRDye 800CW goat anti-rabbit IgG, H + L (Li-Cor cat # 926-32211), IRDye 680LT goat anti-Mouse IgG2b (Li-Cor cat # 926-68052), IRDye 800CW goat anti-mouse IgG H + L (Li-Cor cat # 926-32210) and IRDye 680LT goat anti-rabbit IgG H + L.
Densitometry measurements were performed using the soft- ware Image Studio Lite v4.0 (Li-Cor) by determining the signal intensity of each band after a background optimization and nor- malizing to GAPDH.
2.11. Statistical analysis
Statistical analysis was conducted using one-way ANOVA fol- lowed by Tukey’s correction for confidence intervals and significance (GraphPad Prism version 5). For the survival analysis the log-rank (Mantel-Cox) test was used. Statistical significance was assumed if the p value was < 0.05.
3. Results
3.1. Overexpression of activin-pc modulates sex-cord stromal tumors but does not alter adrenal tumorigenesis or survival in a-KO mice
By 8 weeks of age all the analyzed o-KO animals displayed tes- ticular and ovarian sex-cord tumors. A total of 97.50% of the testis tubules in the sham-operated o-KO mice displayed Sertoli cell tumors (p <0.0001 versus WT) and 94% of female o-KO mice showed granu- losa cell tumors of the ovarian tissue (p < 0.0001 versus WT). Microscopic foci of nodular proliferation and hemorrhage foci were clearly visible in both testes and ovaries causing a complete dis- ruption of both follicular and tubular structure. Overexpression of activin-Bc reduced the percentage of tumor in testes (21.75% versus WT p <0.0001) and ovaries (35% versus WT p <0.0001) with a significant reduction compared to the a-KO mice (testis - 75.5% p < 0.0001) and (ovaries - 59.25% p < 0.0001) (Figure 1A and B).
The adrenal tumors in the gonadectomized o-KO mice were in- creased compared to WT control mice in both males (+57.07 ±6.12% p < 0.0001) and females (+67.34 ±9.00% p <0.0001) upon gonad- ectomy (Figure 2A and B). The adrenal weight was significantly increased in a-KO mice (males 70 ± 20 mg p < 0.05 and females 80 ±20 mg p<0.01) compared to WT controls (males 6± 1 mg and
females 7 ± 1 mg) consistent with the development of adrenocor- tical carcinoma observed in these animals (Figures 2C, D and 3).
Overexpression of activin-ßc did not increase survival in the x-KO/ ActC++ male mice compared to the a-KO (Figure 2E and F). When survival was assessed for the female mice, the a-KO/ActC++ group displayed reduced survival compared to the a-KO counterpart. At 28 weeks of age 27.2% of a-KO/ActC++ female mice survived versus 56.79% of a-KO female mice (Chi-square 5.008 p <0.05).
Histological analysis revealed that the adrenal tumors were en- capsulated, focally hemorrhagic and necrotic. Significant differences were noted comparing the adrenal tissue of the a-KO or a-KO/ ActC++ mice to the WT or ActC++ mice. In fact, in the adrenal from a WT mice the cells in the cortex (outer layer) could be easily iden- tified as eosinophilic and arranged in defined zones compared to the medulla (inner layer). Tumors in the a-KO or a-KO/ActC++ mice were composed of solid nests of polygonal cells with uniform, central round nuclei and a significant amount of eosinophilic cytoplasm (Figure 4A and B).
3.2. Overexpression of activin-Bc does not alter apoptosis or proliferation in a-KO mice
Apoptosis was markedly decreased in the a-KO groups with a resulting increase in proliferation in both male (Figure 5A and C) and female mice (Figure 5B and D; Supplementary Figures S1-S4).
The reduction in apoptosis and increase in proliferation were not noted in the sham operated animals as expected (Supplementary Figure S5-S9). No tumors were recorded in the sham operated groups as expected (Supplementary Figures S10 and S11).
PCR analysis was undertaken to confirm expression of the transgene in the adrenal tissue when activin-pc was over-expressed. No detectable level of expression was noted in adrenals of both male and female WT mice. In ActC++ mice activin-Bc expression was evident in both male (Figure 5E) and female groups (Figure 5F).
3.3. Overexpression of activin-Bc does not alter the serum levels of activin-A in the a-KO mice
The serum levels of activin-A were elevated in the a-KO male and female mice consistent with the development of adrenal tumors secreting activin-A (Matzuk et al., 1994); overexpression of activin- Bc did not reduce the elevated levels of serum activin-A, in fact no statistically significant difference was noted in the a-KO mice versus the o .- KO/ActC++ for both male and female mice (Figure 6).
WT
α-ΚΟ
a-KO/ActC++
1 cm
A
WT
ActC++
a-KO
a-KO/ACtC++
B
WT
ActC++
a-KO
a-KO/ACtC++
100 um
MALES
FEMALES
A
B
ns
60-
60-
ns
ns
Apoptosis (%)
Apoptosis (%)
ns
ns
40-
40-
**
ns
ns
*
20-
20-
0
WT
ActC++
a-KO
a-KO/ActC++
0
WT
ActC++
a-KO
a-KO/ActC++
C
ns
D
ns
*
100-
100-
80-
**
PCNA (%)
80-
PCNA (%)
60-
60-
ns
40-
40-
20-
20-
0
0
WT
ActC++
a-KO
a-KO/ActC++
WT
ActC++
a-KO
a-KO/ActC++
E
F
WT
ActC++
NC
WT
ActC++
NC
activin-BC
300 bp
activin-BC
300 bp
200 bp
200 bp
ß-actin
400 bp
ß-actin
400 bp
300 bp
300 bp
3.4. Activation of Smad2 was evident in adrenal tumors from a-KO mice and a-KO/ActC++ mice
The protein levels of follistatin were not statistically different across the experimental groups in both male (Figure 7A) and female mice (Figure 7B). The protein levels of the activin receptor-IIB were not statistically different across the experimental groups in the male mice (Figure 7C) but up-regulated in the female o-KO (p<0.001) and a-KO/ActC++ (p <0.0001) mice versus WT controls (Figure 7D). The p-smad2/Smad2 levels were up-regulated in the o-KO (p <0.001 male mice; p < 0.05 female mice) and a-KO/ActC++ mice (p <0.001 male mice; p < 0.001 male mice; p < 0.05 female mice) versus WT controls (Figure 7E and F).
4. Discussion
Since the first study showing the presence of inhibin and activin in the human adrenal gland (Voutilainen et al., 1991), it has been
reported that these proteins can exert several effects on adrenal func- tion (Hofland et al., 2006).
Studies conducted in the inhibin-deficient mouse model (a-KO), which develops primary testicular and ovarian sex cord- stromal tumors spontaneously and adrenocortical carcinoma upon gonadectomy, clearly demonstrate that inhibin is a tumor suppres- sor gene with gonadal and adrenal specificity (Matzuk et al., 1994). Both gonadal and adrenal tumors secrete high levels of activin-A, due to a disrupted inhibin/activin signaling pathway and also sec- ondary to the tumor development.
We showed that overexpression of activin-Bc reduced the pro- gression of testicular and ovarian tumors, and we previously showed that it reduces the cachexia-like phenotype in the inhibin-deficient mice. Overexpression of activin-Bc reduced the serum levels of activin-A and increased the survival rates in these mice (Gold et al., 2013).
In another study we assessed the protein expression profile of inhibin and activins in human adrenocortical carcinomas and other
A
ns
200
Activin A (pg/ml)
150-
100-
ns
50-
0
WT
ActC++
a-KO
a-KO/ActC++
B
ns
250-
Activin A (pg/ml)
200-
150-
100-
ns
50-
0
WT
ActC++
a-KO
a-KO/ActC++
adrenal pathologies versus normal controls and we reported that the inhibin-a protein expression was reduced in adrenocortical car- cinomas versus adrenocortical adenomas whereas activin-A was increased (Marino et al., 2014). These findings agreed with a pre- vious report showing that INHA (inhibin-a) was among the genes which had discriminatingly low expression in adrenocortical car- cinomas compared with adenomas and proposing inhibin-a as a suitable immunohistochemical marker in the histological evalua- tion for the differentiation from non-adrenocortical tumors, such as pheochromocytomas or renal cell carcinomas (Choi et al., 2000).
The aim of this study was to assess the impact of overexpression of activin-ßc on adrenal tumorigenesis and survival in gonadecto- mized versus sham-operated inhibin-deficient mice and controls. Tumor percent, tumor weight, markers of apoptosis and prolifer- ation and serum levels of activin-A were assessed. Additionally, follistatin, activin receptor-IIB and p-smad2/smad2 were assessed in the same animals to determine if any change in these proteins, central to the activin/TGF-ß signaling pathway, was present.
The current study failed to support a role for activin-Bc in the onset of adrenocortical carcinomas. In fact, overexpression of activin-Bc did not affect the tumor weight or markers of apoptosis/
proliferation in the a-KO/ActC++ mice versus the a-KO controls. No difference was noted for the survival rate in the male a-KO/ ActC++ mice compared to the o-KO counterpart. Additionally, survival rate in the female o-KO /ActC++ mice was reduced compared to the a-KO. As expected, the serum levels of activin-A were increased in the a-KO male and female mice, but no statistically significant dif- ference was noted between the a-KO and a-KO/ActC++ mice. Additionally, overexpression of activin-ßc did not antagonize the ac- tivation of pSmad-2 in the adrenals of the o-KO mice.
Interestingly, this result was different compared to our previ- ous study, where we showed that over-expression of activin-Bc clearly had an effect on the cachexia-like phenotype and survival in non gonadectomized mice (Gold et al., 2013).
It has been proposed that the murine adrenal tumors are in- sensitive to activin-A. In fact, activin-A has been shown to inhibit proliferation, induce apoptosis and modulate adrenocorticotropic hormone (ACTH)-induced cortisol secretion in the adrenal fetal zone (Spencer et al., 1992, 1999). Experiments conducted in cells derived from murine o-KO adrenal cells showed that tumors are unrespon- sive to activin-A treatment, which explains the growth of adrenal tumors despite the fact that the tumor itself secretes high levels of activin-A (Looyenga and Hammer, 2006).
Smad2 levels were reduced in adrenal tumors of the inhibin- deficient mice (Beuschlein et al., 2004). We also showed that Smad2 levels were not increased in human adrenocortical carcinomas despite a clear increase of activin-A (Marino et al., 2014). However, the present study investigated the pSmad2/Smad2 levels in the adrenals of the a-KO mice and we did find a statistically signifi- cant up-regulation in both male and female mice. The increased pSmad2 levels are suggestive of an activin/TGF-ß signaling. However, it is important to consider that many other ligands of the TGF-ß su- perfamily signal through the Smad pathway. Therefore, activation of Smad2 does not indicate that adrenal tumors are responsive to activin-A or that they signal through activin-A. Other ligands might be responsible of the downstream signaling; TGF-ß2 for example, implicated in gonadectomy induced adrenocortical tumor forma- tion in the inhibin deficient mice, is up-regulated in murine adrenal cancers (Looyenga et al., 2010).
Surprisingly, activin-Bc did not reduce the pSmad2/Smad2 ac- tivation in the a-KO/ActC++ versus a-KO mice. In our previous studies (Gold et al., 2009, 2013) we showed that activin-Bc antagonizes the activin signaling pathway reducing the pSmad2/Smad2 levels. This antagonistic effect was particularly evident when activin-A is leading the activation of intracellular effector Smad2, in fact, in the non go- nadectomized «-KO mice developing gonadal cancers (sensitive to activin-A), over-expression of activin-Bc reduced the pSmad2/ Smad2 activation in gonadal tissues, resulting in reduction of tumor load and cancer-cachexia (Gold et al., 2013). We also previously showed that activin-C binds to the activin-receptors IIA and IIB and antagonizes the pSmad2 activation in vitro and in vivo (Gold et al., 2013; Marino et al., 2014). In the context of adrenal tumors this an- tagonistic mechanism is lost. Therefore, one has to conclude that activation of pSmad2 is caused by other members of the TGF-ß su- perfamily, like TGF-ß2, which binds to the TGF-ß receptor 1 and not to the activin-receptors IIA or IIB.
It is currently unknown why adrenal tumors are insensitive to activin-A. However, it has been previously shown that cancer cells can acquire resistance to the anti-proliferative effect of TGF-ß and activin by a number of different mechanisms. These include defects in the surface receptors and/or mutational inactivation of down- stream effectors of the signaling pathway (Massagué, 1998). Mutations in several other TGF-ß superfamily receptors and Smad proteins were described in some human cancer tissues (Elliott and Blobe, 2005; Massague, 2000). To the best of our knowledge, mutation analysis to the activin signaling effectors in adrenal cancers has not been described. Our data show the presence of activin
MALES
FEMALES
A
1.5
B
1.5
ns
Follistatin
1.0
ns
ns
Follistatin
1.0
ns
ns
ns
0.5
0.5
0.0
0.0
WT
ActC++
a -KO
a-KO/ActC++
WT
ActC++
a-KO
a -KO/ActC++
Follistatin
Follistatin
GAPDH
GAPDH
ns
C
1.5
D
4
ns
ns
ns
ActRIIB
1.0
ActRIIB
3
2
0.5
ns
1
0.0
WT
ActC++
a-KO
a-KO/ActC++
0
WT
ActC++
a -KO
aKO/ActC++
ActRIIB
ActRIIB
GAPDH
GAPDH
E
ns
F
ns
3
**
**
p-Smad2/Smad2
4
p-Smad2/Smad2
*
*
3
2
2
1
1
ns
ns
0
WT
ActC++
a -KO
a-KO/ActC++
0
WT
ActC++
a -KO
a-KO/ActC++
Smad-2
Smad-2
pSmad-2
pSmad-2
GAPDH
GAPDH
receptor IIB in WT, ActC++, o-KO and a-KO mice with up-regulated levels in the female a-KO and o-KO/ActC++ mice versus WT con- trols. Additionally, no changes in the follistatin levels were evident. These data suggest that the adrenal tumors insensitivity to activin-A is not due to reduced expression of the receptor for activin-A or in- creased expression of follistatin (an antagonist of activin-A).
Our previous study, conducted in human gonadal and adrenal cancers, showed a substantial difference in the expression profile of activin-C in gonadal versus adrenal tumors. Expression of activin-C was increased in human gonadal tumors but not in human adrenal
tumors (Marino et al., 2014). Additionally, activin-C is expressed in normal ovarian and testicular tissues, both in mouse and human, but its expression is limited in normal human adrenals (Marino et al., 2014). In the present study we showed that activin-C is below the detectable levels in WT animals versus over-expressing activin-Bc mice using block PCR. These data, taken together, suggest that activin-C might have an important and independent function (in- dependent to activin-A) in the regulation of gonadal homeostasis (e.g. autocrine effect) when produced at high levels, and no effect in the regulation of adrenal homeostasis.
It is also important to consider that a different gene expression profile has been reported between adrenal and gonadal tumors. In fact, Looyenga and co-workers reported a series of genes not de- tectable in the gonadal tumors but strongly detectable or increased in expression in the adrenal tumors, including the transcription factor Gata4 and the specific transcripts that are direct transcriptional targets of Gata4 (Looyenga and Hammer, 2006). This significant dif- ference might also be responsible for a different intrinsic response of adrenal tumors to activins.
In conclusion the present study reinforces the importance of activin-Bc as an essential protein in reproductive biology and sug- gests that activin-Bc is not essential for the regulation of adrenal tumorigenesis. Future studies will have to clarify the effect of activin- Bc on adrenal homeostasis and if this protein affects adrenal cells and their functions (e.g. hormone secretion, cell proliferation and differentiation).
Acknowledgment
The authors thank SylviaZellhuber-McMillan for her technical as- sistance and the staff of the Histology Laboratory (Department of Pathology - University of Otago) for processing and sectioning the histological slides.
F.E.M designed the study, carried out data collection, data anal- ysis and wrote the manuscript. E.G. designed the study and wrote the manuscript. G.R. designed the study and revised the manu- script. All authors have read and approved the final version. This work was supported by a National Health and Medical Research Council Australia Project Grant (1008058; to G.R.), and a Universi- ty of Otago Doctoral Scholarship (to F.E.M.).
Appendix: Supplementary material
Supplementary data to this article can be found online at doi:10.1016/j.mce.2015.04.004.
References
Arola, J., Liu, J., Heikkila, P., Ilvesmaki, V., Salmenkivi, K., Voutilainen, R., et al., 2000. Expression of inhibin alpha in adrenocortical tumours reflects the hormonal status of the neoplasm. J. Endocrinol. 165, 223-229.
Beuschlein, F., Looyenga, B.D., Bleasdale, S.E., Mutch, C., Bavers, D.L., Parlow, A.F., et al., 2003. Activin induces x-zone apoptosis that inhibits luteinizing hormone- dependent adrenocortical tumor formation in inhibin-deficient mice. Mol. Cell. Biol. 23, 3951-3964.
Beuschlein, F., Looyenga, B., Reincke, M., Hammer, G., 2004. Role of the inhibin/activin system and luteinizing hormone in adrenocortical tumorigenesis. Horm. Metab. Res. 36, 392-396.
Bukowski, R.M., Wolfe, M., Levine, H.S., Crawford, D.E., Stephens, R.L., Gaynor, E., et al., 1993. Phase II trial of mitotane and cisplatin in patients with adrenal carcinoma: a Southwest Oncology Group study. J. Clin. Oncol. 11, 161-165.
Choi, Y .- L., Kim, H .- S., Ahn, G., 2000. Immunoexpression of Inhibin o. Subunit, Inhibin/Activin BA Subunit and CD99 in Ovarian Tumors. Arch. Pathol. Lab. Med. 124, 563-569.
Counihan, N.A., Rawlinson, S.M., Lindenbach, B.D., 2011. Trafficking of hepatitis C virus core protein during virus particle assembly. PLoS Pathog. 7, e1002302.
Dackiw, A.P., Lee, J.E., Gagel, R.F., Evans, D.B., 2001. Adrenal cortical carcinoma. World J. Surg. 25, 914-926.
Elliott, R.L., Blobe, G.C., 2005. Role of transforming growth factor beta in human cancer. J. Clin. Oncol. 23, 2078-2093.
Gavrieli, Y., Sherman, Y., Ben-Sasson, S.A., 1992. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol. 119, 493-501.
Gold, E., Jetly, N., O’Bryan, M.K., Meachem, S., Srinivasan, D., Behuria, S., et al., 2009. Activin C antagonizes activin A in vitro and overexpression leads to pathologies in vivo. Am. J. Pathol. 174, 184-195.
Gold, E., Marino, F.E., Harrison, C., Makanji, Y., Risbridger, G., 2013. Activin-Bc reduces reproductive tumour progression and abolishes cancer-associated cachexia in inhibin-deficient mice. J. Pathol. 229, 599-607.
Gold, E.J., Zhang, X., Wheatley, A.M., Mellor, S.L., Cranfield, M., Risbridger, G.P., et al., 2005. betaA- and betaC-activin, follistatin, activin receptor mRNA and betaC- activin peptide expression during rat liver regeneration. J. Mol. Endocrinol. 34, 505-515.
Grumbach, M.M., Biller, B.M., Braunstein, G.D., Campbell, K.K., Carney, J.A., Godley, P.A., et al., 2003. Management of the clinically inapparent adrenal mass (“incidentaloma”). Ann. Intern. Med. 138, 424-429.
Hofland, J., de Jong, F.H., 2012. Inhibins and activins: their roles in the adrenal gland and the development of adrenocortical tumors. Mol. Cell. Endocrinol. 359, 92-100. Hofland, J., Timmerman, M.A., De Herder, W.W., Van Schaik, R.H.N., De Krijger, R.R., De Jong, F.H., 2006. Expression of activin and inhibin subunits, receptors and binding proteins in human adrenocortical neoplasms. Clin. Endocrinol. (Oxf) 65, 792-799.
Lau, A.L., Kumar, T.R., Nishimori, K., Bonadio, J., Matzuk, M.M., 2000. Activin BC and ßE genes are not essential for mouse liver growth, differentiation, and regeneration. Mol. Cell. Biol. 20, 6127-6137.
Ling, N., Ying, S.Y., Ueno, N., Esch, F., Denoroy, L., Guillemin, R., 1985. Isolation and partial characterization of a Mr 32,000 protein with inhibin activity from porcine follicular fluid. PNAS 82, 7217-7221.
Lipsett, M.B., Hertz, R., Ross, G.T., 1963. Clinical and pathophysiologic aspects of adrenocortical carcinoma. Am. J. Med. 35, 374-383.
Looyenga, B.D., Hammer, G.D., 2006. Origin and identity of adrenocortical tumors in inhibin knockout mice: implications for cellular plasticity in the adrenal cortex. Mol. Endocrinol. 20, 2848-2863.
Looyenga, B.D., Wiater, E., Vale, W., Hammer, G.D., 2010. Inhibin-A antagonizes TGFß2 signaling by down-regulating cell surface expression of the TGFB coreceptor betaglycan. Mol. Endocrinol. 24, 608-620.
Makarev, E., Gorivodsky, M., 2014. Islet1 and its co-factor Ldb1 are expressed in quiescent cells of mouse intestinal epithelium. PLoS ONE 9, e95256.
Mantero, F., Terzolo, M., Arnaldi, G., Osella, G., Masini, A.M., Alì, A., et al., 2000. A survey on adrenal incidentaloma in Italy 1. J. Clin. Endocrinol. Metab. 85, 637-644. Marino, F.E., Risbridger, G., Gold, E., 2014. The inhibin/activin signalling pathway in human gonadal and adrenal cancers. Mol. Hum. Reprod. 20, 1223-1237.
Massagué, J., 1998. TGF-ß signal transduction. Annu. Rev. Biochem. 67, 753-791. Massague, J., 2000. How cells read TGF-[beta] signals. Nat. Rev. Mol. Cell Biol. 1, 169-178.
Matzuk, M., Finegold, M., Mather, J., Krummen, L., Lu, H., Bradley, A., 1994. Development of cancer cachexia-like syndrome and adrenal tumors in inhibin- deficient mice. PNAS 91, 8817-8821.
Matzuk, M.M., Finegold, M.J., Su, J .- G.J., Hsueh, A.J.W., Bradley, A., 1992. alpha-Inhibin is a tumour-suppressor gene with gonadal specificity in mice. Nature 360, 313-319.
McPherson, S.J., Hussain, S., Balanathan, P., Hedwards, S.L., Niranjan, B., Grant, M., et al., 2010. Estrogen receptor-ß activated apoptosis in benign hyperplasia and cancer of the prostate is androgen independent and TNFo mediated. PNAS 107, 3123-3128.
Mellor, S.L., Cranfield, M., Ries, R., Pedersen, J., Cancilla, B., De Kretser, D., et al., 2000. Localization of activin BA-,ß B-, and ß C-subunits in human prostate and evidence for formation of new activin heterodimers of ß C-subunit. J. Clin. Endocrinol. Metab. 85, 4851-4858.
Miyamoto, K., Hasegawa, Y., Fukuda, M., Nomura, M., Igarashi, M., Kangawa, K., et al., 1985. Isolation of porcine follicular fluid inhibin of 32K daltons. Biochem. Biophys. Res. Commun. 129, 396-403.
Rivier, J., Spiess, J., McClintock, R., Vaughan, J., Vale, W., 1985. Purification and partial characterization of inhibin from porcine follicular fluid. Biochem. Biophys. Res. Commun. 133, 120-127.
Robertson, D.M., Foulds, L.M., Leversha, L., Morgan, F.J., Hearn, M.T.W., Burger, H.G., et al., 1985. Isolation of inhibin from bovine follicular fluid. Biochem. Biophys. Res. Commun. 126, 220-226.
Spencer, S.J., Rabinovici, J., Mesiano, S., Goldsmith, P.C., Jaffe, R.B., 1992. Activin and inhibin in the human adrenal gland. Regulation and differential effects in fetal and adult cells. J. Clin. Invest. 90, 1420149.
Spencer, S.J., Mesiano, S., Lee, J.Y., Jaffe, R.B., 1999. Proliferation and apoptosis in the human adrenal cortex during the fetal and perinatal periods: implications for growth and remodeling 1. The J. Clin. Endocrinol. Metab. 84, 1110-1115.
Vanttinen, T., Liu, J., Kuulasmaa, T., Kivinen, P., Voutilainen, R., 2003. Expression of activin/inhibin signaling components in the human adrenal gland and the effects of activins and inhibins on adrenocortical steroidogenesis and apoptosis. J. Endocrinol. 178, 479-489.
Voutilainen, R., Erämaa, M., Rivtos, O., 1991. Hormonally regulated inhibin gene expression in human fetal and adult adrenals. J. Clin. Endocrinol. Metab. 73, 1026-1030.
Woodruff, T.K., Krummen, L., Chen, S.A., Lyon, R., Hansen, S.E., Deguzman, G., et al., 1993. Pharmacokinetic profile of recombinant human (rh) inhibin A and activin A in the immature rat. II. Tissue distribution of [125I] rh-inhibin A and [125I] rh-activin A in immature female and male rats. Endocrinology 132, 725-734.