Effects of neonicotinoids on promoter-specific expression and activity of aromatase (CYP19) in human adrenocortical carcinoma (H295R) and primary umbilical vein endothelial (HUVEC) cells
Élyse Caron-Beaudoin*, Michael S. Denison™ and J. Thomas Sanderson*
* INRS - Institut Armand-Frappier, Université du Québec, Laval, QC, CANADA elyse.caron-beaudoin@iaf.inrs.ca; thomas.sanderson@iaf.inrs.ca
+ Department of Environmental Toxicology, University of California, Davis, CA msdenison@ucdavis.edu
Corresponding author and contact information:
J. Thomas Sanderson INRS-Institut Armand-Frappier 531 boulevard des Prairies Laval QC H7V 1B7 CANADA T. 450 687-5010 ext 8819 E. thomas.sanderson@iaf.inrs.ca
Running Title: In vitro effects of neonicotinoids on aromatase
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
ABSTRACT
The enzyme aromatase (CYP19; cytochrome P450 19) in humans undergoes highly tissue- and promoter-specific regulation. In hormone-dependent breast cancer, aromatase is over-expressed via several normally inactive promoters (PII, I.3, I.7). Aromatase biosynthesizes estrogens, which stimulate breast cancer cell proliferation. The placenta produces estrogens required for healthy pregnancy and the major placental CYP19 promoter is I.1. Exposure to certain pesticides, such as atrazine, is associated with increased CYP19 expression, but little is known about the effects of neonicotinoid insecticides on CYP19. We developed sensitive and robust RT-qPCR methods to detect the promoter-specific expression of CYP19 in human adrenocortical carcinoma (H295R) and primary umbilical vein endothelial (HUVEC) cells, and determined the potential promoter-specific disruption of CYP19 expression by atrazine and the commonly used neonicotinoids imidacloprid, thiacloprid and thiamethoxam. In H295R cells, atrazine concentration-dependently increased PII- and I.3-mediated CYP19 expression and aromatase catalytic activity. Thiacloprid and thiamethoxam induced PII and I.3-mediated CYP19 expression and aromatase activity at relatively low concentrations (0.1-1.0 uM), exhibiting non-monotonic concentration-response curves with a decline in gene induction and catalytic activity at higher concentrations. In HUVEC cells, atrazine slightly induced overall (promoter-indistinct) CYP19 expression (30 uM) and aromatase activity (≥ 3 uM), without increasing I.1 promoter activity. None of the neonicotinoids increased CYP19 expression or aromatase activity in HUVEC cells. Considering the importance of promoter-specific (over)expression of CYP19 in disease (breast cancer) or during sensitive developmental periods (pregnancy), our newly developed RT-qPCR methods will be helpful tools in assessing the risk that neonicotinoids and other chemicals may pose to exposed women.
Keywords: neonicotinoids, aromatase, promoter-specific, CYP19, H295R, HUVEC
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
INTRODUCTION
Neonicotinoids are members of a relatively new class of neuro-active insecticides that are used as seed coatings in large quantities to protect crops against pest (Tomizawa and Casida, 2005). Neonicotinoids are registered in 120 countries and their use is steadily increasing (Jeschke et al., 2010), especially in corn, canola, soybeans and the majority of fruits and vegetables. The insecticidal action of neonicotinoids is based on their relatively high selectivity for nicotinergic receptors in insects, where they act as an agonist of the postsynaptic acetylcholine receptor (Matsuda et al., 2001). Among the most commonly used neonicotinoids are imidacloprid, thiacloprid and thiamethoxam (Jeschke et al., 2010).
Neonicotinoids have been associated with Colony Collapse Disorder of honey bees (Girolami et al., 2009; Henry et al., 2012). Neonicotinoids are systemic insecticides, which means they are soluble in water and absorbed by the tissues of the plant, and bees can be exposed to these chemicals through nectar and pollen (Rortais et al., 2005). An exposure to a non-acutely lethal dose of thiamethoxam and imidacloprid causes a delayed onset of increased mortality in honey bees (Henry et al., 2012) and a decrease in their foraging activity (Decourtye et al., 2004). Neonicotinoids are also toxic to birds and mammals. For example, imidacloprid (2 and 8 mg/kg/day) adversely affects the reproductive system of male rats, by inducing DNA fragmentation, antioxidant imbalance and apoptosis (Bal et al., 2012). Moreover, epididymal weight and sperm concentration were lower in imidacloprid exposed rats (Bal et al., 2012). An exposure of female rats to imidacloprid (20 mg/kg/day) caused a decrease in ovarian weight, induced changes in granulosa cells of follicles (cytoplasmic clumping, lipofuscin accumulation) and altered levels of luteinizing and follicle stimulating hormones and progesterone (Kapoor et al., 2011). Daily oral administration of the neonicotinoid clothianidin to female quails caused
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
abnormal ovarian histology of the granulosa cells and a decrease in glutathione peroxidase 4 and manganese superoxide dismutase, two enzymes that protect against oxidative stress (Hoshi et al., 2014). Furthermore, a 30-day exposure to thiacloprid (112.5 mg/kg) increased the serum levels of free thyroxine and triiodothyronine in rats (Sekeroglu et al., 2014), demonstrating the endocrine disrupting potential of this class of pesticides. Given these observations and the increasing use of neonicotinoids, a much better understanding of their potential effects on human health is needed.
In North America, breast cancer represents a third of all female cancer diagnoses (OMS, 2013) and 70 % of breast cancers are estrogen-dependent. In the majority of these cancers, the enzyme aromatase (CYP19) is over-expressed. CYP19 is responsible for the biosynthesis of estrogens, which stimulate the proliferation of estrogen-dependent breast cancer cells (Ghosh et al., 2009). CYP19 is present in a variety of tissues and its gene expression is regulated by different tissue-specific promoters. In normal breast tissue, aromatase is expressed at a low level via the CYP19 promoter I.4. However, in breast cancer, CYP19 promoters pII, I.3 and I.7 become active, whereas they are silent in the healthy mammary gland (Bulun et al., 2007). There is evidence that exposure to endocrine disruptors may increase the risk of developing hormone- dependent breast cancer via pro-estrogenic mechanisms (Birnbaum and Fenton, 2003), although focus has been mainly on estrogen receptor activation (Lemaire et al., 2006; Bouskine et al., 2009). Effects on aromatase and consequences for human health are less well understood. It has been demonstrated that exposure to atrazine, a widely used herbicide, induces aromatase expression and estrogen biosynthesis in certain human cell lines (Sanderson et al., 2001; Sanderson et al., 2002; Thibeault et al., 2014), but the effects of chemicals on the promoter- and tissue-specific expression of aromatase are largely unknown. In placenta, CYP19 is expressed
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
mainly via the placenta-specific promoter I.1, and the estrogens produced are essential for proper development of placenta and foetus (Bukovsky et al., 2003; Albrecht and Pepe, 2010).
In this study we developed quantitative real-time PCR techniques to determine the effects of neonicotinoids on CYP19 gene expression via the breast cancer-relevant promoters PII and I.3, and the pregnancy-relevant placental promoter I.1, using two model human cell lines, adrenocortical carcinoma cells (H295R) and primary umbilical vein endothelial cells (HUVEC).
MATERIALS AND METHODS
Pesticides. All pesticides were obtained from Sigma-Aldrich (Saint-Louis, MO) (atrazine Pestanal® #45330, purity > 99 %; thiacloprid Pestanal® #37905 purity > 99 %; thiamethoxam Pestanal® #37924, purity > 99 %; imidacloprid Pestanal® #37894, purity > 99 %) and were dissolved in dimethylsulfoxide (DMSO) as 100 mM stock solutions.
In vitro models. The H295R cell line was selected for this study since it expresses all enzymes required for steroidogenesis de novo (Gazdar et al., 1990; Rainey et al., 1994; Hilscherova et al., 2004; Zhang et al., 2005; Sanderson, 2009) and the expression of CYP19 in this cell line is regulated by two breast cancer-relevant promoters (PII and I.3) (Sanderson et al., 2004), making it a suitable model for the study of CYP19 expression and aromatase activity. It is also approved be the Organization for Economic Cooperation and Development as a tier 1 screening tool for chemically induced disruption of steroidogenesis (OECD, 2011). HUVEC cells were selected, because they were reported to express CYP19 by its endothelial promoter I.7 (Alvarez-Garcia et al., 2013) and have never been evaluated for additional CYP19 promoter activities. Moreover, HUVEC are primary cells and are more likely to have a realistic regulation of promoter-specific CYP19 expression.
Cell culture. H295R cells (ATCC no. CRL-2128) were obtained from the American Type Culture Collection. H295R cells were cultured in Dulbecco’s modified Eagle medium/Ham’s F- 12 nutrient mix (DMEM/F12) containing 365 mg/ml of L-glutamine. Medium was completed with ITS+ Premix (Fisher Scientific, Waltham, MA) (final concentration in medium: 6.25 µg/ml insulin; 6.25 µg/ml transferrin; 6.25 ng/ml selenium; 1.25 mg/ml bovine serum albumin; 5.35 ug/ml linoleic acid) and Nu-serum (VWR International, Radnor, PA) at a final concentration of 2.5 %. Primary HUVEC (ATCC no. PCS-100-010) cells were obtained from the American Type Culture Collection. Primary HUVEC cells were cultured in Vascular Cell Basal Medium completed with the Endothelial Cell Growth Kit-VEGF (ATCC no. PCS-100-041). Complete growth medium contained 5 ng/ml recombinant human (rh) VEGF, 5 ng/ml rh EGF, 5 ng/ml rh- FGF basic, 15 ng/ml rh-IGF-1, 10 mM L-glutamine, 0.75 units/ml heparin sulfate, 1 µg/ml hydrocortisone, 2 % fetal bovine serum and 50 µg/ml ascorbic acid.
Cell viability. The toxicity of atrazine and the neonicotinoids to H295R and HUVEC was determined using a WST-1 kit (Roche, Basel, Switzerland) which measures mitochondrial reductase activity of viable cells. H295R and primary HUVEC cells were plated in 96-well plates (5x103 cells/well) in their appropriate culture medium for 24 h. After this acclimatization period, cells were exposed to fresh medium containing increasing concentrations of atrazine, thiacloprid, thiamethoxam or imidacloprid for another 24 h. Cells were then incubated with WST-1 substrate for 1.5 h and the formation of formezan was then measured using the absorbance at 440 nm with SpectraMax M5 spectrophotometer (Molecular Devices, Sunnyvale, CA). Each experiment was conducted in triplicate and repeated twice using different cell passages.
RNA isolation and amplification by quantitative RT-PCR. Real-time quantitative PCR (qPCR) is a well-established method used to determine gene expression levels. Strong RNA quality control,
primer design and choice of reference genes (Taylor et al., 2010) are the key to achieving valid results. Therefore, careful consideration was given to the experimental design and qPCR validation. H295R and primary HUVEC cells were cultured in CellBind 6-well plates (Corning Incorporated, Corning, NY) (750,000 cells/well) containing 2 ml medium/well for 24 h. Cells were then exposed for 24 h to the various pesticides. Forskolin (Sigma-Aldrich) was used as a positive control for activation of PII- and I.3 promoter-mediated CYP19 gene expression and phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich) for I.1 promoter activation. DMSO vehicle (0.1 %) was used as negative control. The 24 h exposure time was selected based on preliminary time-response experiments (0, 12, 24, 48 and 72 h) using forskolin, PMA, atrazine and imidacloprid, which demonstrated that maximal (promoter-specific and promoter-indistinct) CYP19 gene expression occurred at 24 h. RNA was isolated using an RNeasy mini-kit (Qiagen, Mississauga, ON) according to the enclosed instruction, and stored at -80 ℃. Purity of the RNA samples was determined using the 260 nm/280 nm absorbance ratio. Reverse transcription was performed using 0.5 µg of RNA with an iScript cDNA Synthesis Kit (BioRad, Hercules, CA) and T3000 Thermocycler (Biometra, Göttingen, Germany); resultant cDNA was stored at -20 ℃. Primer pairs were designed to amplify mRNA species containing an untranslated 5’ region uniquely derived from each of the promoters (pII, I.3, I.4 and I.7) utilized for CYP19 gene expression; a primer pair designed to recognize only the coding region (exons II-X) was used to amplify overall (promoter non-distinct) CYP19 transcript. All the primer pairs were analyzed with Blast and Primer-Blast to ensure that the target sequences were unique to the gene or promoter region in question and that the product length was between 75-150 bp (Taylor et al., 2010). Real-time quantitative PCR was performed using EvaGreen MasterMix (BioRad) with CFX96 Real-Time PCR Detection System (BioRad) (95 ℃ for 5 min; 40 cycles of 95 ℃ for 5
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
sec and 60 °℃ for 15 sec). Standard curves for amplification by each primer pair to ensure an efficiency between 90 % and 110 % and 12 value greater than 0.95 (Table 1; only PII, I.3 and I.1 promoter activity was detected in our cell models). Each experiment was conducted in triplicate and repeated twice using different cell passages.
For each pesticide and cell line, two suitable reference genes were included for normalization of CYP19 gene expression (Table 2). Widely used reference genes such as glyceraldehyde 3-phosphate dehydrogenase (GADPH), 18S or ß-actin are not always suitable, since their expression can be highly variable dependent on experimental conditions (Aerts et al., 2004; Radonić et al., 2004). In our case, it is crucial to evaluate the stability of the expression of different potential reference genes in each cell type and for each treatment. We determined suitable reference genes using the geNorm algorithm method (Biogazelle qbase Plus software, Zwijnaarde, Belgium) to calculate the target stability for each given condition (Taylor et al., 2010). All reference genes met the criterion for gene expression stability of having an (M) value below 0.5.
Aromatase catalytic activity. Aromatase activity was measured using a tritiated water-release assay as described previously (Lephart and Simpson, 1991; Sanderson et al., 2000). Briefly, H295R and primary HUVEC cells were cultured in 24-well plates (250,000 or 400,000 cells/well, respectively) containing 1 ml of the appropriate culture medium. After 24 h, cells were exposed to various concentrations of pesticides and incubated for 24 h. The treated medium was then removed and cells were washed twice with 500 uL PBS 1X. A volume of 250 uL of culture medium (without phenol red) containing 54 nM 13-3H-androstenedione was added to each well, and cells were incubated for 90 (H295R) or 150 (HUVEC) minutes at 37°℃ (5 % CO2). Further steps were as described previously (Sanderson et al., 2000). Tritiated water was
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
counted in 24-well plates containing liquid scintillation cocktail using a Microbeta Trilux (PerkinElmer, Waltham, MA, USA). Counts per minute produced by each sample were corrected for quenching to determine disintegrations per minute, which were then converted into aromatase activity (fg/h/100,000 cells) and then expressed as a percent of control activity (DMSO). Formestane (1 µM), a selective and irreversible aromatase inhibitor, was used to ensure specificity for the aromatase reaction.
Statistical analysis. Results are presented as means with standard errors of three independent experiments using different cell passages; per experiment, each concentration was tested in triplicate. The normal distribution of the residuals and the homoscedasticity of the data were verified for each analysis using JMP Software (SAS, Cary, NC). Statistically significant differences (* p<0.05; ** p<0.01; *** p<0.001) from control were determined by one-way ANOVA followed by a Dunnett post-hoc test to correct for multiple comparisons to control using GraphPad Prism v5.04 (GraphPad Software, San Diego, CA).
RESULTS
Effects of neonicotinoids on cell viability of H295R and primary HUVEC cells
A 24 h exposure to increasing concentrations of atrazine (0.3, 3, 10, 30 µM), imidacloprid (3, 10, 30 uM), thiacloprid or thiamethoxam (0.1, 0.3, 3, 10, 30 uM) did not statistically affect the viability of H295R (Fig 1A) or primary HUVEC cells (Fig 1B) based on mitochondrial reductase activity.
Effects of atrazine and neonicotinoids on promoter-specific CYP19 expression in H295R cells
We determined the effects of a 24 h exposure to atrazine and three neonicotinoids on the PII and I.3 promoter-specific expression of CYP19 in H295R cells. Our positive control forskolin (10
uM) increased PII- and 1.3-derived CYP19 mRNA levels by 11.6 ± 2.6 and 13.0 ± 3.0 fold, respectively, and promoter-indistinct CYP19 mRNA levels by 3.8 ± 0.6 uM. No evidence of I.4 or I.1 promoter activity was found in H295R cells (not shown). Atrazine increased levels of PII and I.3 promoter-derived CYP19 transcript levels in a concentration-dependent manner, resulting in a 6-fold induction at 30 uM (Fig 2A), as has been described previously (Heneweer et al., 2004; Fan et al., 2007). A 24 h exposure of H295R cells to thiacloprid resulted in a statistically significant increase in relative levels of promoter-indistinct CYP19 mRNA at 0.3 and 10 uM (12.1 and 2.7 fold, respectively) as well as statistically significant increases in relative levels of PII- and I.3-derived CYP19 transcript (4.6 and 3.0 fold, respectively) at 0.3 uM (Fig 2B). Thiamethoxam at 0.1 uM strongly increased promoter-indistinct CYP19 expression and expression via promoters PII and I.3 (Fig 2C) by almost equal extents (between 12.2 and 15.7 fold). PII-derived mRNA levels were also significantly elevated (2.6 fold) at 0.3 uM (Fig 2C). A 24 h exposure to 3 uM imidacloprid caused a statistically significant decrease of about 60 % in the expression of promoter-indistinct CYP19 mRNA levels as well as the levels of PII- and I.3- derived CYP19 transcript (Fig 2D).
Effects of atrazine and neonicotinoids on promoter-specific CYP19 expression in HUVEC cells
HUVEC cells, which are primary cells of endothelial origin derived from human umbilical cord, were found to express aromatase via the major placental CYP19 promoter I.1. Neither PII, I.3, I.4 nor I.7 CYP19 promoter activity was detected in HUVEC cells. We also did not detect endothelial I.7 CYP19 promoter activity in primary HUVEC cells using our qPCR method, neither with published primer pairs that were reported to detect I.7 promoter activity in these cells (Alvarez-Garcia et al., 2013), nor with our own primer designs. On average, PMA induced
levels of promoter-indistinct (coding region) CYP19 mRNA by 3.3 + 0.3 fold and levels of I.1 promoter-derived mRNA by 2.5 ± 0.3 fold (Fig 3A-D). Atrazine slightly induced the expression of promoter non-distinct CYP19 transcript, with a statistically significant increase of 1.9 ± 0.2 fold at 30 uM, but had had no statistically significant effects on I.1 promoter activity (Fig 3A). The neonicotinoids did not affect overall or I.1 promoter-mediated CYP19 expression in HUVEC cells at any tested concentrations (Fig 3B-D).
Effects of atrazine and neonicotinoids on CYP19 catalytic activity in H295R and HUVEC cells
To confirm whether the pesticide-induced changes in promoter-specific CYP19 gene expression observed in H295R and primary HUVEC cells resulted in similar changes in catalytic activity of the final enzyme product, we measured the concentration-dependent effects of each pesticide on aromatase activity in each cell type. In H295R cells, forskolin (10 µM) was used as a positive control for induction of CYP19 and increased aromatase activity by 5.3 + 2.2 fold compared to DMSO control, whereas formestane (1 uM), a positive control for inhibition of aromatase activity, reduced activity by about 77 to 90 % (not shown). In H295R cells, atrazine concentration-dependently induced aromatase activity, increasing it by about 2 fold at 30 uM (Fig 4A); this is consistent with the observed increase in the promoter-specific expression of CYP19 transcript in these cells (Fig 2A). Thiacloprid and thiamethoxam induced aromatase activity statistically significantly at concentrations between 0.1 and 3 uM, producing biphasic concentration-response curves, with each pesticide having maximal effect at about 1 uM (Fig 4A). Imidacloprid had no effect on aromatase activity in H295R cells within the tested concentration range (Fig 4A).
In primary HUVEC cells, PMA (1 µM), a positive control for promoter I.1-controlled induction of CYP19 gene expression, induced aromatase activity, on average, by 2.4 ± 0.3 fold compared to DMSO control, whereas formestane (1 uM) inhibited aromatase activity by 80 to 100 % (not shown). In primary HUVEC cells, atrazine induced aromatase activity concentration- dependently with statistically significant increases at 3 and 30 uM (Fig 4B). Neither imidacloprid nor thiamethoxam induced aromatase activity in a statistically significant manner (Fig 4B). At 0.1 uM, thiacloprid induced aromatase activity by 3.5 fold, which was statistically significant (Fig 4B).
Discussion
Effects of pesticides on the promoter-specific regulation of CYP19 in H295R cells. Using atrazine as a positive control, our results confirm that this widely used herbicide is an effective inducer of aromatase via the promoters pII and I.3 in H295R cells. These effects are well documented and consistent with other studies (Sanderson et al., 2000; Sanderson et al., 2002; Fan et al., 2007). Atrazine, at concentrations higher than those currently found in the environment, also disrupted ovarian and hypothalamic function in rats, causing altered LH and prolactin synthesis (Cooper et al., 2000), and induced aromatase expression via a steroidogenic factor-1 (SF-1) dependent pathway in H295R cells (Fan et al., 2007). At environmentally relevant levels, atrazine exposure reduced growth rate in red drum larvae (Sciaenops ocellatus) exposed to 40 and 80 µg/L for 96 h (del Carmen Alvarez, 2005). Moreover, a study conducted in Texas coast demonstrated that atrazine levels in runoff water can reach 40 to 65 µg/L (Pennington et al., 2001). Therefore, the observed induction of CYP19 expression and activity by
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
atrazine at a concentration as low as 300 nM (H295R cells), lies within an environmentally relevant range.
To our knowledge, we are the first to document the in vitro effects of neonicotinoids on the promoter-specific expression of CYP19 and the catalytic activity of aromatase. In our study, thiacloprid and thiamethoxam strongly induced the expression of PII and I.3 promoter-derived CYP19 mRNA in H295R cells, which is a well-established in vitro model for the study of steroidogenesis (OECD, 2011). The strong increase in expression of total (coding region) CYP19 transcript in H295R cells exposed to 0.3 uM thiacloprid relative to the weaker increase in PII- and I.3-derived transcript levels appears to suggest the presence of other, possibly unknown, aromatase promoters or promoter-independent mechanisms of transactivation in these cells. (We confirmed that neither I.1-, I.4- nor I.7-promoter activity was present in H295R cells under our experimental conditions.) Among the neonicotinoids, thiacloprid and thiamethoxam had the greatest effects on pII- and I.3-promoter-specific CYP19 expression in H295R cells. These effects occurred at relatively low concentrations, producing biphasic or non-monotonic concentration-response curves. Although an alteration in mRNA expression does not necessarily result in a change in protein expression or enzyme activity, we show that thiacloprid and thiamethoxam altered promoter-specific CYP19 mRNA expression as well as catalytic activity (which we consider a more relevant endpoint in an in vivo context) in a non-monotonic manner. In toxicologically studies of endocrine disrupting chemicals, this type of biphasic response is not uncommon (Kennedy et al., 1993; Sanderson et al., 1998; Giesy et al., 2000; Calabrese and Baldwin, 2001a; Calabrese and Baldwin, 2001b; Jobling et al., 2003; Rivest et al., 2011; Vandenberg et al., 2012). For example, bisphenol A binds the estrogen receptor at low concentrations, but also acts as an antiandrogen at higher ones (Sohoni and Sumpter, 1998) and
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
we have recently shown that androgen receptors are expressed in H295R cells (Robitaille et al., 2014). This concentration-dependent selectivity of bisphenol A for several hormone receptors was suggested to explain the non-monotonic shape of the resultant concentration-estrogenic response curve (Vandenberg et al., 2012). Also, exposure of rats to phtalates leads to a biphasic effect on aromatase activity. This was partially explained by a change in testosterone availability and by the inhibitory action of phtalate metabolites on CYP19 transcript levels (Andrade et al., 2006). Moreover, Jobling et al. (2003) demonstrated that a three week exposure to ethinylestradiol and bisphenol A in prosobrach mollusc (Potamopyrgus antipodarum) stimulated embryo production in an inverted U-shaped dose-response manner, where lower concentrations had a greater effect (Jobling et al., 2003). Another study conducted on fathead minnow (Pimophales promelas) exposed to 4-nonylphenol (NP) demonstrated an effect of this chemical on egg production and plasma vitellogenin levels, resulting in an inverted U-shape dose-response curve (Giesy et al., 2000). It remains unclear how thiacloprid and thiamethoxam produced a non- monotonic response on CYP19 expression and aromatase activity in H295R cells, but it may activate (or deactivate) different intracellular signalling factors that affect CYP19 promoter activity at different concentrations. The action of atrazine on PII/I.3-mediated CYP19 expression occurs by increasing intracellular levels of cAMP (Sanderson et al., 2002) and possibly by interacting with SF-1 (Fan et al., 2007). It is further known that cAMP-mediated phosphorylation of GATA-4 is involved in SF-1 activation and subsequent stimulation of the CYP19 PII promoter (Tremblay and Viger, 2003). It is not known whether atrazine activates GATA-4 and it remains to be studied whether thiacloprid and thiamethoxam act as potent inducers via these signalling pathways or by other yet to be delineated mechanisms. Further insight into the mechanisms of induction of CYP19 by neonicotinoids is important in understanding their
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
promoter-specificity and explaining the non-monotonicity of their concentration-response curves. This will be addressed in further studies.
Evidence of other adverse or endocrine disruptive effects of neonicotinoids has been observed in recent studies, with imidacloprid inducing apoptosis and fragmentation of seminal DNA in rats (Bal et al., 2012), and causing oxidative stress and hormone disruption in female rats (Kapoor et al., 2011). Moreover, few studies demonstrated that half-lives of certain neonicotinoids, like imidacloprid, may exceed 1000 days and that around 90 % of the active ingredient in neonicotinoid formulations enters the soil (Goulson, 2013). These characteristics indicate that bioaccumulation of these pesticides may occur and eventually cause sub-chronic toxicities, which re-enforce the need of toxicological studies on neonicotinoids.
Effects of pesticides on the promoter-specific regulation of CYP19 in primary HUVEC cells.
We are the first to evaluate the effects of atrazine and neonicotinoids on CYP19 expression and aromatase activity in primary endothelial HUVEC cells. RT-qPCR analyses showed that HUVEC cells express CYP19 (Mukherjee et al., 2002) via the placental PKC-driven I.1 promoter and is stimulated by the phorbol ester PMA. Atrazine increased promoter non-distinct CYP19 mRNA expression statistically significantly, but this increase in transcript was not derived from the I.1 promoter as its activity remained unchanged (Fig 3A). A possible explanation could be the presence of another CYP19 promoter that drives the observed changes in CYP19 expression levels, possibly the endothelium-specific I.7 promoter (Bulun et al., 2003) or an unknown one, although we could not detect any transcript using the currently published sequence for the 5’- untranslated region of I.7 promoter-derived mRNA that was discovered in breast cancer tissues (Sebastian et al., 2002). Other mechanisms such as inhibition of mRNA degradation could also play a role. The absence of statistically significant effects of the neonicotinoids on aromatase
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
activity in HUVEC cells was consistent with the lack of effects on CYP19 expression at the mRNA level (Fig 3B-D and 4B). We note that basal aromatase activity in HUVEC cells (2 fmole/h/105 cells) is considerably lower than in H295R cells (118 fmole/h/105 cells) and less inducible by its positive control PMA (2.4 fold) than by forskolin in H295R cells (5.3 fold). However, given the induction of CYP19 expression and aromatase activity observed with atrazine, endothelial cells (such as HUVEC) should not be ignored as a potential target for endocrine disrupting pesticides and other environmental contaminants. For example, HUVEC cells exposed to environmentally relevant doses of bisphenol A have higher expression of proangiogenic genes such as VEGFR (Andersson and Brittebo, 2012) and exhibit mitotic abnormalities during cell division (Ribeiro-Varandas et al., 2013).
Relevance of disruption of promoter-specific CYP19 expression in health and disease. The H295R cell line is a useful in vitro model for the study of the effects of chemicals on the PII- and I.3-promoter-specific expression of CYP19. The activity of the PII and I.3 promoters of CYP19 are associated with the over-expression of aromatase in the adipose stromal cells surrounding hormone-dependent breast tumors (Bulun et al., 2007; Chen et al., 2009). The consequence of induction of CYP19 via these two promoters would be an increased local production of estrogens in close proximity to the tumor, increasing the likelihood of cancer cell proliferation. The involvement of the PII promoter in CYP19 over-expression has also been established in ovarian cancer (Bulun et al., 2007) and endometriosis, where the adipose-specific I.4 promoter also appears to be involved (Zeitoun et al., 1999). Moreover, obesity is associated with higher expression of aromatase in breast fibroblasts via promoters PII/I.3, and women suffering from obesity have greater risk of developing breast cancer (Bulun et al., 2012). One of the suggested pathways linking obesity with breast cancer and aromatase over-expression is the increased
production of prostaglandin E2 (PGE2), known to induce aromatase expression via promoters pII and I.3 (Chen et al., 2007). Considering the importance of the promoter-specific character of CYP19 expression in various tissues and disease states as well as during pregnancy, our finding that atrazine and certain neonicotinoid pesticides can modulate CYP19 in a promoter-specific manner emphasizes the need for further study of the potential disruptive effects of environmental contaminants on steroidogenesis.
Whether human exposures to environmental contaminants that disrupt CYP19 expression and aromatase activity are sufficiently high to cause or contribute to human disease is an important question that remains to be answered. Atrazine is found in surface waters (Smalling et al., 2015) and in agricultural products (Viden et al., 1987) at concentrations that have been linked to reproductive abnormalities in amphibians (Hayes et al., 2003) and effects on CYP19 expression in the brains of tadpoles of the bullfrog (Rana catesbeiana) (Gunderson et al., 2011). Furthermore, atrazine is detected in breast milk (Balduini et al., 2003) confirming that infant exposures may occur during a critical developmental period. With regards to the neonicotinoids, levels of clothianidin and thiamethoxam have been steadily increasing since 2012 in water samples from wetlands and agricultural areas in United States and Canada (concentrations ranging from 0.002 ug/L to 3.6 µg/L) (Anderson et al., 2013; Main et al., 2014; Smalling et al., 2015). Since a large number of studies demonstrate a link between exposures to environmental contaminants and increased risk of breast cancer (Dewailly et al., 1994; Birnbaum and Fenton, 2003; Fenton, 2006; Bonefeld-Jorgensen et al., 2011) or adverse birth outcomes (Rinsky et al., 2012; Vafeiadi et al., 2014), the increasing use and reliance on chemicals such as pesticides remains a cause of concern.
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
CONCLUSIONS
We have successfully developed RT-qPCR methods for the quantitative determination of the promoter-specific expression of CYP19. We have shown that the H295R cell line is a useful in vitro model for the study of chemicals that may interfere with the PII- and I.3 promoter-specific expression of CYP19 and that primary HUVEC cells express CYP19 via the placenta-type I.1 promoter. To fully understand the promoter-specific regulation of CYP19 in HUVEC or other endothelial cells, further studies would be helpful to assess the activation pathway(s) of the endothelial I.7 promoter. Finally, we are the first to show that neonicotinoid insecticides have the potential to increase the expression of CYP19 in a promoter-specific manner. Given the importance of the promoter-specific expression of CYP19 in breast cancer or during pregnancy, it is important to study how endocrine disrupting chemicals may affect the activity of individual CYP19 promoters in order to better understand and predict the potential risk to exposed women.
FUNDING
This work was supported financially by the California Breast Cancer Research Program (CBCRP grant no. 17UB-8703) to MSD and JTS, and by the Natural Sciences and Engineering Research Council of Canada (NSERC Discovery grant no. 313313-2012) to JTS. ECB was the recipient of a scholarship from the Fonds de recherche du Québec - Nature et technologies (FRQNT).
Declaration of conflict of interest: We declare to have no financial conflicts of interest.
ACKNOWLEDGEMENTS
We thank Andree-Anne Hudon-Thibault, Joey St-Pierre and the laboratory of Cathy Vaillancourt for assistance with the RT-qPCR methodology.
REFERENCES
Aerts, J. L., Gonzales, M. I., and Topalian, S. L. (2004). Selection of appropriate control genes to assess expression of tumor antigens using real-time RT-PCR. Biotechniques 36, 84-86, 88, 90-81.
Albrecht, E. D., and Pepe, G. J. (2010). Estrogen regulation of placental angiogenesis and fetal ovarian development during primate pregnancy. The International journal of developmental biology 54, 397-408.
Alvarez-Garcia, V., Gonzalez, A., Martinez-Campa, C., Alonso-Gonzalez, C., and Cos, S. (2013). Melatonin modulates aromatase activity and expression in endothelial cells. Oncology reports 29, 2058-2064.
Anderson, T. A., Salice, C. J., Erickson, R. A., McMurry, S. T., Cox, S. B., and Smith, L. M. (2013). Effects of landuse and precipitation on pesticides and water quality in playa lakes of the southern high plains. Chemosphere 92, 84-90.
Andersson, H., and Brittebo, E. (2012). Proangiogenic effects of environmentally relevant levels of bisphenol A in human primary endothelial cells. Archives of Toxicology 86, 465-474.
Andrade, A. J., Grande, S. W., Talsness, C. E., Grote, K., and Chahoud, I. (2006). A dose- response study following in utero and lactational exposure to di-(2-ethylhexyl)- phthalate (DEHP): non-monotonic dose-response and low dose effects on rat brain aromatase activity. Toxicology 227, 185-192.
Bal, R., Naziroğlu, M., Türk, G., Yilmaz, Ö., Kuloğlu, T., Etem, E., and Baydas, G. (2012). Insecticide imidacloprid induces morphological and DNA damage through oxidative toxicity on the reproductive organs of developing male rats. Cell Biochemistry and Function 30, 492-499.
Balduini, L., Matoga, M., Cavalli, E., Seilles, E., Riethmuller, D., Thomassin, M., and Guillaume, Y. C. (2003). Triazinic herbicide determination by gas chromatography-mass spectrometry in breast milk. Journal of Chromatography B 794, 389-395.
Birnbaum, L. S., and Fenton, S. E. (2003). Cancer and developmental exposure to endocrine disruptors. Environ Health Perspect 111, 389-394.
Bonefeld-Jorgensen, E. C., Long, M., Bossi, R., Ayotte, P., Asmund, G., Kruger, T., Ghisari, M., Mulvad, G., Kern, P., Nzulumiki, P., and Dewailly, E. (2011). Perfluorinated compounds are related to breast cancer risk in Greenlandic Inuit: a case control study. Environ Health 10, 88.
Bouskine, A., Nebout, M., Brucker-Davis, F., Benahmed, M., and Fenichel, P. (2009). Low doses of bisphenol A promote human seminoma cell proliferation by activating PKA and PKG via a membrane G-protein-coupled estrogen receptor. Environ Health Perspect 117, 1053-1058.
Bukovsky, A., Cekanova, M., Caudle, M., Wimalasena, J., Foster, J., Henley, D., and Elder, R. (2003). Expression and localization of estrogen receptor-alpha protein in normal and abnormal term placentae and stimulation of trophoblast differentiation by estradiol. Reproductive Biology and Endocrinology 1, 13.
Bulun, S. E., Chen, D., Lu, M., Zhao, H., Cheng, Y., Demura, M., Yilmaz, B., Martin, R., Utsunomiya, H., Thung, S., Su, E., Marsh, E., Hakim, A., Yin, P., Ishikawa, H., Amin, S., Imir, G., Gurates, B., Attar, E., Reierstad, S., Innes, J., and Lin, Z. (2007). Aromatase excess in cancers of breast, endometrium and ovary. J Steroid Biochem Mol Biol 106, 81-96.
Bulun, S. E., Chen, D., Moy, I., Brooks, D. C., and Zhao, H. (2012). Aromatase, breast cancer and obesity: a complex interaction. Trends Endocrinol Metab 23, 83-89.
Bulun, S. E., Sebastian, S., Takayama, K., Suzuki, T., Sasano, H., and Shozu, M. (2003). The human CYP19 (aromatase P450) gene: update on physiologic roles and genomic organization of promoters. J Steroid Biochem Mol Biol 86, 219-224.
Calabrese, E. J., and Baldwin, L. A. (2001a). The frequency of U-shaped dose responses in the toxicological literature. Toxicol Sci 62, 330-338.
Calabrese, E. J., and Baldwin, L. A. (2001b). Hormesis: U-shaped dose responses and their centrality in toxicology. Trends in pharmacological sciences 22, 285-291.
Chen, D., Reierstad, S., Lin, Z., Lu, M., Brooks, C., Li, N., Innes, J., and Bulun, S. E. (2007). Prostaglandin E(2) induces breast cancer related aromatase promoters via activation of p38 and c-Jun NH(2)-terminal kinase in adipose fibroblasts. Cancer Res 67, 8914-8922.
Chen, D., Reierstad, S., Lu, M., Lin, Z., Ishikawa, H., and Bulun, S. E. (2009). Regulation of breast cancer-associated aromatase promoters. Cancer Lett 273, 15-27.
Cooper, R. L., Stoker, T. E., Tyrey, L., Goldman, J. M., and McElroy, W. K. (2000). Atrazine disrupts the hypothalamic control of pituitary-ovarian function. Toxicol. Sci. 53, 297- 307.
Decourtye, A., Devillers, J., Cluzeau, S., Charreton, M., and Pham-Delègue, M .- H. (2004). Effects of imidacloprid and deltamethrin on associative learning in honeybees under semi-field and laboratory conditions. Ecotoxicology and environmental safety 57, 410-419.
Dewailly, E., Dodin, S., Verreault, R., Ayotte, P., Sauve, L., Morin, J., and Brisson, J. (1994). High organochlorine body burden in women with estrogen receptor-positive breast cancer. Journal of the National Cancer Institute 86, 232-234.
Fan, W., Yanase, T., Morinaga, H., Gondo, S., Okabe, T., Nomura, M., Hayes, T. B., Takayanagi, R., and Nawata, H. (2007). Herbicide atrazine activates SF-1 by direct affinity and concomitant co-activators recruitments to induce aromatase expression via promoter II. Biochem Biophys Res Commun 355, 1012-1018.
Fenton, S. E. (2006). Endocrine-Disrupting Compounds and Mammary Gland Development: Early Exposure and Later Life Consequences. Endocrinology 147, s18-s24.
Gazdar, A. F., Oie, H. K., Shackleton, C. H., Chen, T. R., Triche, T. J., Myers, C. E., Chrousos, G. P., Brennan, M. F., Stein, C. A., and La Rocca, R. V. (1990). Establishment and characterization of a human adrenocortical carcinoma cell line that expresses multiple pathways of steroid biosynthesis. Cancer Res 50, 5488-5496.
Ghosh, D., Griswold, J., Erman, M., and Pangborn, W. (2009). Structural basis for androgen specificity and oestrogen synthesis in human aromatase. Nature 457, 219-223. Giesy, J. P., Pierens, S. L., Snyder, E. M., Miles-Richardson, S., Kramer, V. J., Snyder, S. A., Nichols, K. M., and Villeneuve, D. A. (2000). Effects of 4-nonylphenol on fecundity and biomarkers of estrogenicity in fathead minnows (Pimephales promelas). Environmental Toxicology and Chemistry 19, 1368-1377.
Girolami, V., Mazzon, L., Squartini, A., Mori, N., Marzaro, M., Bernardo, A. D., Greatti, M., Giorio, C., and Tapparo, A. (2009). Translocation of Neonicotinoid Insecticides from
Coated Seeds to Seedling Guttation Drops: A Novel Way of Intoxication for Bees. Journal of Economic Entomology 102, 1808-1815.
Gunderson, M. P., Veldhoen, N., Skirrow, R. C., Macnab, M. K., Ding, W., van Aggelen, G., and Helbing, C. C. (2011). Effect of low dose exposure to the herbicide atrazine and its metabolite on cytochrome P450 aromatase and steroidogenic factor-1 mRNA levels in the brain of premetamorphic bullfrog tadpoles (Rana catesbeiana). Aquatic toxicology 102, 31-38.
Hayes, T., Haston, K., Tsui, M., Hoang, A., Haeffele, C., and Vonk, A. (2003). Atrazine-induced hermaphroditism at 0.1 ppb in American leopard frogs (Rana pipiens): laboratory and field evidence. Environ Health Perspect 111, 568-575.
Heneweer, M., van den Berg, M., and Sanderson, J. T. (2004). A comparison of human H295R and rat R2C cell lines as in vitro screening tools for effects on aromatase. Toxicol Lett 146, 183-194.
Henry, M., Béguin, M., Requier, F., Rollin, O., Odoux, J .- F., Aupinel, P., Aptel, J., Tchamitchian, S., and Decourtye, A. (2012). A Common Pesticide Decreases Foraging Success and Survival in Honey Bees. Science 336, 348-350.
Hilscherova, K., Jones, P. D., Gracia, T., Newsted, J. L., Zhang, X., Sanderson, J. T., Yu, R. M., Wu, R. S., and Giesy, J. P. (2004). Assessment of the effects of chemicals on the expression of ten steroidogenic genes in the H295R cell line using real-time PCR. Toxicol Sci 81, 78-89.
Hoshi, N., Hirano, T., Omotehara, T., Tokumoto, J., Umemura, Y., Mantani, Y., Tanida, T., Warita, K., Tabuchi, Y., Yokoyama, T., and Kitagawa, H. (2014). Insight into the Mechanism of Reproductive Dysfunction Caused by Neonicotinoid Pesticides. Biological and Pharmaceutical Bulletin 37, 1439-1443.
Jeschke, P., Nauen, R., Schindler, M., and Elbert, A. (2010). Overview of the Status and Global Strategy for Neonicotinoids. Journal of Agricultural and Food Chemistry 59, 2897- 2908.
Jobling, S., Casey, D., Rodgers-Gray, T., Oehlmann, J., Schulte-Oehlmann, U., Pawlowski, S., Baunbeck, T., Turner, A. P., and Tyler, C. R. (2003). Comparative responses of molluscs and fish to environmental estrogens and an estrogenic effluent. Aquatic toxicology 65, 205-220.
Kapoor, U., Srivastava, M. K., and Srivastava, L. P. (2011). Toxicological impact of technical imidacloprid on ovarian morphology, hormones and antioxidant enzymes in female rats. Food and Chemical Toxicology 49, 3086-3089.
Kennedy, S. W., Lorenzen, A., James, C. A., and Collins, B. T. (1993). Ethoxyresorufin-O- deethylase and porphyrin analysis in chicken embryo hepatocyte cultures with a fluorescence multiwell plate reader. Anal Biochem 211, 102-112.
Klempan, T., Hudon-Thibeault, A. A., Oufkir, T., Vaillancourt, C., and Sanderson, J. T. (2011). Stimulation of serotonergic 5-HT2A receptor signaling increases placental aromatase (CYP19) activity and expression in BeWo and JEG-3 human choriocarcinoma cells. Placenta 32, 651-656.
Lemaire, G., Mnif, W., Mauvais, P., Balaguer, P., and Rahmani, R. (2006). Activation of a- and ß-estrogen receptors by persistent pesticides in reporter cell lines. Life sciences 79, 1160-1169.
Lephart, E. D., and Simpson, E. R. (1991). Assay of aromatase activity. Methods in enzymology 206, 477-483.
Main, A. R., Headley, J. V., Peru, K. M., Michel, N. L., Cessna, A. J., and Morrissey, C. A. (2014). Widespread Use and Frequent Detection of Neonicotinoid Insecticides in Wetlands of Canada’s Prairie Pothole Region. PloS one 9, e92821.
Matsuda, K., Ihara, M., Nishimura, K., Sattelle, D. B., and Komai, K. (2001). Insecticidal and neural activities of candidate photoaffinity probes for neonicotinoid binding sites. Bioscience, biotechnology, and biochemistry 65, 1534-1541.
Mukherjee, T. K., Dinh, H., Chaudhuri, G., and Nathan, L. (2002). Testosterone attenuates expression of vascular cell adhesion molecule-1 by conversion to estradiol by aromatase in endothelial cells: Implications in atherosclerosis. Proceedings of the National Academy of Sciences 99, 4055-4060.
OECD (2011). Test No. 456: H295R Steroidogenesis Assay, OECD Guidelines for the Testing of Chemicals, Section 4. OECD Publishing, Paris.
OMS (2013). Organisation mondiale de la Santé: Rapport historique sur les effets pour l’homme de l’exposition aux perturbateurs endocriniens chimiques.
Radonić, A., Thulke, S., Mackay, I. M., Landt, O., Siegert, W., and Nitsche, A. (2004). Guideline to reference gene selection for quantitative real-time PCR. Biochemical and Biophysical Research Communications 313, 856-862.
Rainey, W. E., Bird, I. M., and Mason, J. I. (1994). The NCI-H295 cell line: a pluripotent model for human adrenocortical studies. Mol Cell Endocrinol 100, 45-50.
Ribeiro-Varandas, E., Viegas, W., Sofia Pereira, H., and Delgado, M. (2013). Bisphenol A at concentrations found in human serum induces aneugenic effects in endothelial cells. Mutation Research/Genetic Toxicology and Environmental Mutagenesis 751, 27-33. Rinsky, J. L., Hopenhayn, C., Golla, V., Browning, S., and Bush, H. M. (2012). Atrazine exposure in public drinking water and preterm birth. Public health reports 127, 72- 80.
Rivest, P., Renaud, M., and Sanderson, J. T. (2011). Proliferative and androgenic effects of indirubin derivatives in LNCaP human prostate cancer cells at sub-apoptotic concentrations. Chem Biol Interact 189, 177-185.
Rortais, A., Arnold, G., Halm, M .- P., and Touffet-Briens, F. (2005). Modes of honeybees exposure to systemic insecticides: estimated amounts of contaminated pollen and nectar consumed by different categories of bees. Apidologie 36, 71-83.
Sanderson, J. T. (2009). Adrenocortical toxicology in vitro: Assessment of steroidogenic enzyme expression and steroid production in H295R cells. In Adrenal Toxicology (P. W. Harvey, D. J. Everett, and C. J. Springall, Eds.), pp. 175-182. Informa Healthcare, New York, NY.
Sanderson, J. T., Boerma, J., Lansbergen, G. W., and van den Berg, M. (2002). Induction and inhibition of aromatase (CYP19) activity by various classes of pesticides in H295R human adrenocortical carcinoma cells. Toxicol Appl Pharmacol 182, 44-54.
Sanderson, J. T., Hordijk, J., Denison, M. S., Springsteel, M. F., Nantz, M. H., and Van Den Berg, M. (2004). Induction and Inhibition of aromatase (CYP19) activity by natural and synthetic flavonoid compounds in H295R human adrenocortical carcinoma cells. Toxicol Sci 82, 70-79.
Sanderson, J. T., Kennedy, S. W., and Giesy, J. P. (1998). In vitro induction of ethoxyresorufin O-deethylase activity and porphyrins by polyhalogenated aromatic hydrocarbons in avian primary hepatocytes. Environmental Toxicology and Chemistry 17, 2006-2018.
Sanderson, J. T., Letcher, R. J., Heneweer, M., Giesy, J. P., and van den Berg, M. (2001). Effects of chloro-s-triazine herbicides and metabolites on aromatase activity in various human cell lines and on vitellogenin production in male carp hepatocytes. Environ Health Perspect 109, 1027-1031.
Sanderson, J. T., Seinen, W., Giesy, J. P., and van den Berg, M. (2000). 2-Chloro-s-triazine herbicides induce aromatase (CYP19) activity in H295R human adrenocortical carcinoma cells: a novel mechanism for estrogenicity? Toxicol Sci 54, 121-127.
Sebastian, S., Takayama, K., Shozu, M., and Bulun, S. E. (2002). Cloning and characterization of a novel endothelial promoter of the human CYP19 (aromatase P450) gene that is up-regulated in breast cancer tissue. Mol Endocrinol 16, 2243-2254.
Sekeroglu, V., Sekeroglu, Z. A., and Demirhan, E. (2014). Effects of commercial formulations of deltamethrin and/or thiacloprid on thyroid hormone levels in rat serum. Toxicol Ind Health 30, 40-46.
Smalling, K. L., Reeves, R., Muths, E., Vandever, M., Battaglin, W. A., Hladik, M. L., and Pierce, C. L. (2015). Pesticide concentrations in frog tissue and wetland habitats in a landscape dominated by agriculture. Science of The Total Environment 502, 80-90.
Sohoni, P., and Sumpter, J. P. (1998). Several environmental oestrogens are also anti- androgens. J Endocrinol 158, 327-339.
Taylor, S., Wakem, M., Dijkman, G., Alsarraj, M., and Nguyen, M. (2010). A practical approach to RT-qPCR-Publishing data that conform to the MIQE guidelines. Methods 50, S1-5.
Thibeault, A. A., Deroy, K., Vaillancourt, C., and Sanderson, J. T. (2014). A unique co-culture model for fundamental and applied studies of human fetoplacental steroidogenesis and interference by environmental chemicals. Environ Health Perspect 122, 371- 377.
Tomizawa, M., and Casida, J. E. (2005). Neonicotinoid Insecticide Toxicology: Mechanisms of Selective Action. Annual Review of Pharmacology and Toxicology 45, 247-268.
Tremblay, J. J., and Viger, R. S. (2003). Novel roles for GATA transcription factors in the regulation of steroidogenesis. J Steroid Biochem Mol Biol 85, 291-298.
Vafeiadi, M., Vrijheid, M., Fthenou, E., Chalkiadaki, G., Rantakokko, P., Kiviranta, H., Kyrtopoulos, S. A., Chatzi, L., and Kogevinas, M. (2014). Persistent organic pollutants exposure during pregnancy, maternal gestational weight gain, and birth outcomes in
the mother-child cohort in Crete, Greece (RHEA study). Environment International 64, 116-123.
Vandenberg, L. N., Colborn, T., Hayes, T. B., Heindel, J. J., Jacobs, D. R., Jr., Lee, D. H., Shioda, T., Soto, A. M., vom Saal, F. S., Welshons, W. V., Zoeller, R. T., and Myers, J. P. (2012). Hormones and endocrine-disrupting chemicals: low-dose effects and nonmonotonic dose responses. Endocr Rev 33, 378-455.
Viden, I., Rathouska, Z., Davidek, J., and Hajslova, J. (1987). Use of gas liquid chromatography/mass spectrometry for triazine herbicide residues analysis in forage and milk. Z. Lebensmitt. Untersuch Forsch. 185, 98-105.
Wang, Y., Man Gho, W., Chan, F. L., Chen, S., and Leung, L. K. (2008). The red clover (Trifolium pratense) isoflavone biochanin A inhibits aromatase activity and expression. Br J Nutr 99, 303-310.
Zeitoun, K., Takayama, K., Michael, M. D., and Bulun, S. E. (1999). Stimulation of aromatase P450 promoter (II) activity in endometriosis and its inhibition in endometrium are regulated by competitive binding of steroidogenic factor-1 and chicken ovalbumin upstream promoter transcription factor to the same cis-acting element. Mol Endocrinol 13, 239-253.
Zhang, X., Yu, R. M., Jones, P. D., Lam, G. K., Newsted, J. L., Gracia, T., Hecker, M., Hilscherova, K., Sanderson, T., Wu, R. S., and Giesy, J. P. (2005). Quantitative RT-PCR methods for evaluating toxicant-induced effects on steroidogenesis using the H295R cell line. Environ Sci Technol 39, 2777-2785.
| CYP19 promoter | Primer pairs (5'-3') | Amplification characteristics | Tissue-specific expression | Reference and accession number |
|---|---|---|---|---|
| CYP19- | Fw: TGTCTCTTTGTTCTTCATGCTATTTCTC | H295R cells: | Detects all aromatase transcripts | (Sanderson et al., |
| coding region | Rv: TCACCAATAACAGTCTGGATTTCC | Standard curve: r2= 0.980 | regardless of promoter utilized. | 2000) |
| Efficiency: 101.0 % | M22246 | |||
| HUVEC cells: | ||||
| Standard curve: r= 0.995 | ||||
| Efficiency: 110.0 % | ||||
| CYP19-I.1 | Fw: GGATCTTCCAGACGTCGCGA Rv: CATGGCTTCAGGCACGATGC | HUVEC cells: | Placenta-specific aromatase transcript. | Klempan et al. (2011) NM_000103 |
| r2: 0.966 | ||||
| Efficiency: 94.3 % | ||||
| CYP19-PII | Fw: TCTGTCCCTTTGATTTCCACAG Rv: GCACGATGCTGGTGATGTTATA | H295R cells: | Expressed in ovaries, testes and stroma of breast cancer patients | Heneweer et al. (2004) |
| Standard curve: 12 = 0.977 | S52794 | |||
| Efficiency: 108.5 % | ||||
| CYP19-I.3 | Fw: GGGCTTCCTTGTTTTGACTTGTAA Rv: AGAGGGGGCAAT TTAGAGTCTGTT | H295R cells | Expressed in ovaries, testes and stroma of breast cancer patients | Wang et al. (2008) D30796 |
| Standard curve: r = 0.960 Efficiency: 102.7 % |
| Cell type | Reference genes | Forward primer (5'-3') Atrazine | Reverse primer (5'-3') |
|---|---|---|---|
| H295R | UBC PBGD | ATTTGGGTCGCGGTTCTTG GGCAATGCGGCTGCAA | TGCCTTGACATTCTCGATGGT GGGTACCCACGCGAATCAC |
| HUVEC | RPII | GCACCACGTCCAATGACAT | GTGCGGCTGCTTCCATAA |
| PBGD | GGCAATGCGGCTGCAA | GGGTACCCACGCGAATCAC |
| Imidacloprid, Thiacloprid, Thiamethoxam | |||
|---|---|---|---|
| H295R | RPII | GCACCACGTCCAATGACAT | GTGCGGCTGCTTCCATAA |
| RPLP0 | GGCGACCTGGAAGTCCAACT | CCATCAGCACCACAGCCTTC | |
| HUVEC | UBC | ATTTGGGTCGCGGTTCTTG | TGCCTTGACATTCTCGATGGT |
| RPLP0 | GGCGACCTGGAAGTCCAACT | CCATCAGCACCACAGCCTTC | |
UBC = ubiquitin C; PBGD = porphobilinogen deaminase; RPII = RNA polymerase II; RPLP0 = 60S acidic ribosomal protein P0.
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
FIGURE LEGENDS
Figure 1. Viability of H295R (A) and HUVEC (B) cells exposed for 24 h to various concentrations of atrazine, thiacloprid, thiamethoxam or imidacloprid as a percentage of DMSO control. No statistically significant difference between pesticide treatments and DMSO control were detected (Kruskal-Wallis test; p>0.05). Each experiment was performed twice using a different cell passage; per experiment each concentration was tested in triplicate.
Figure 2. Relative expression of CYP19 (coding region) or PII- and I.3 promoter-derived CYP19 transcripts in H295R cells exposed for 24 h to various concentrations of atrazine (A), thiacloprid (B), thiamethoxam (C), or imidacloprid (D). Forskolin (Frsk) was used as a positive control for PII/I.3-mediated induction of CYP19 expression. (#) A statistically significant difference between Frsk and DMSO control (Student t-test; p<0.05). (*, ** , *** ) A statistically significant difference between pesticide treatment and DMSO control (one-way ANOVA and Dunnett post- hoc test; * p<0.05; ** p<0.01; *** p<0.001). Experiments were performed in triplicate using different cell passages; per experiment each concentration was tested in triplicate.
Figure 3. Relative expression of CYP19 (coding region) or I.1 promoter-derived CYP19 transcripts in primary HUVEC cells exposed for 24 h to various concentrations of atrazine (A), thiacloprid (B), thiamethoxam (C), or imidacloprid (D). PMA was used as a positive control for induction of I.1-mediated induction of CYP19 expression. (#) A statistically significant difference between PMA treatment and DMSO control (Student t-test; p<0.05). (*, ** , *** ) A statistically significant difference between pesticide treatment and DMSO control (one-way ANOVA and Dunnett post-hoc test; * p<0.05; ** p<0.01; *** p<0.001). Experiments were performed in triplicate using different cell passages; per experiment each concentration was tested in triplicate.
Figure 4. Effect of atrazine, thiacloprid, thiamethoxam and imidacloprid on aromatase activity in H295R (A) and primary HUVEC (B) cells. (*, ** , *** ) A statistically significant difference between pesticide treatment and DMSO control (one-way ANOVA and Dunnett post-hoc test; * p<0.05; ** p<0.01; *** p<0.001). Note: the asterisks (*) in (B) apply to atrazine only. Experiments were performed in triplicate using different cell passages; per experiment each concentration was tested in triplicate.
Downloaded from http://toxsci.oxfordjournals.org/ at University of Glasgow on October 29, 2015
150
H295R cell viability (% DMSO control)
☒ Atrazine
T
☐ Thiacloprid
T
T
T
T
T
T T.
T
100
T
T
T
T
☒ Thiamethoxam
T
T
T.
T
☐ Imidacloprid
50-
0
DMSO
0.1 μ.Μ
0.3 μΜ
3 μΜ
10 μΜ
30 μΜ
HUVEC cell viability (% DMSO control)
150
☒ Atrazine
☐ Thiacloprid
100-
☒ Thiamethoxam
Z
T
Y
T
T
☐ Imidacloprid
50
0
DMSO
0.1 μ.Μ
0.3 μ.Μ
3 μΜ
10 μΜ
30 μΜ
A)
B)
#
Coding region
**
Normalized expression in H295R cells
INWA
2999
PII
Normalized expression in H295R cells
16-
T
T
1.3
14-
8
**
12-
*
10-
6
**
J
8
*
#
T
A
*
6
*
**
**
4.
I
*
2.
T
T
*
T
2.
0
0
DMSO
Frsk 10uM
0.3 µM
3 HM
30 μM
DMSO
Frsk 10uM
0.03 μ.Μ
0.1 µM
0.3 µM
3 µM
10 µM
C)
Atrazine
D)
Thiacloprid
¥
*
**
Normalized expression in H295R cells
25-
20-
15-
T
Normalized expression in H295R cells
T
10
AT
8-
2ª
1. 5
6
1.0
0
T
T
*
*
*
T
T
*
*
T
r
2
0.5
0
Frsk 10uM
0.01µM
0.03 uM
0.1 µM
0.3 uM
3 uM
10 uM
0.0
T
DMSO
DMSO
Frsk 10UM
3 HM
10 µM
30 1M
Thiamethoxam
Imidacloprid
206x171mm (300 × 300 DPI)
A)
B)
#
#
Normalized expression in HUVEC cells
6-
Coding region
Normalized expression in HUVEC cells
4.
1.1
4.
3.
*
2.
2.
1.
0
0
DMSO
PMA 1 µM
0.3 µM
3 µM
10 µM
30 μΜ
DMSO
PMA 1 µM
0.3 LM
3 µM
10 μΜ
Atrazine
Thiacloprid
C)
D)
¥
Normalized expression in HUVEC cells
7-
6.
*
Normalized expression in HUVEC cells
4-
5-
3-
4-
3
2-
T
2-
1.
1.
0
DMSO
ΡΜΑ 1 μ.Μ
0.1 µM
0.3 HM
3 µM
10 μ.Μ
0
DMSO
PMA 1 µM
3 uM
10 μΜ
30 uM
Thiamethoxam
Imidacloprid
206×180mm (300 ×300 DPI)
A)
Aromatase activity in H295R cells (% of control)
200
I
175
Atrazine
Thiacloprid
150
*
Thiamethoxam
*
125
- Imidacloprid
*
*
100
75
25
0
DMSO
0.1 μΜ
0.3 μΜ
1 µM
3 µM
10 uM
30 uM
B)
Aromatase activity in HUVEC cells (% of control)
500
400
Atrazine
- Thiacloprid
300
*
*
Thiamethoxam
Imidacloprid
200-
100-
0
DMSO
0.1 μΜ
0.3 µM
3 µM
10 µM
30 uM