ENDOCRINE PRACTICE Rapid Electronic Article in Press
Rapid Electronic Articles in Press are preprinted manuscripts that have been reviewed and accepted for publication, but have yet to be edited, typeset and finalized. This version of the manuscript will be replaced with the final, published version after it has been published in the print edition of the journal. The final, published version may differ from this proof. DOI:10.4158/EP161580.OR
@ 2016 AACE.
Original Article
EP161580.OR
PURE ANDROGEN-PRODUCING ADRENAL TUMOR: CLINICAL FEATURES AND PATHOGENESIS Anli Tong MD1, Jun Jiang PhD2, Fen Wang MD1, Chunyan Li MD1, Yushi Zhang MD3, Xueyan Wu MD1.
Running title: Pure androgen-producing adrenal tumor
From: Department of Endocrinology, Key Laboratory of Endocrinology, Ministry of Health, Peking Union Medical College Hospital (PUMCH), Chinese Academy of Medical Sciences, Beijing 100730, China; 2The Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101, China; 3Department of Urology, Peking Union Medical College Hospital (PUMCH), Chinese Academy of Medical Sciences, Beijing 100730, China
Correspondence address: Wu XY, Department of Endocrinology, Key Laboratory of Endocrinology, Ministry of Health, Peking Union Medical College Hospital (PUMCH), Chinese Academy of Medical Sciences, Beijing 100730, China. E-mail: wsheyan@vip.sina.com
DOI:10.4158/EP161580.OR c 2016 AACE.
Keywords: adrenocortical tumor, androgen, Aryl hydrocarbon receptor-interacting protein gene, B-catenin, p53
Disclosure statement: The authors have nothing to disclose.
Word count: 3308
Abstract
Objective: Pure androgen-secreting adrenal tumors (PASATs) are extremely rare, most reports involving only a single case. This study examined 9 cases of PASAT, with an attempt to characterize its clinical features and to explore their possible pathogenesis.
Methods: Clinical data of 9 patients with PASAT were retrospectively reviewed. Immunostaining were conducted, and Aryl hydrocarbon receptor-interacting protein (AIP) were amplified and directly sequenced.
Results: The onset age of the patients ranged from 3.5 to 64 years old. All 8 female patients had virilization, while the 7 year-old male patient presented with sexual precocity. Serum testosterone levels were elevated (4.1-52.3 nmol/L). Adrenal masses were detected and removed in all patients, and histologically diagnosed with adrenocortical adenoma or carcinoma. Two patients had both PASATs and growth hormone-secreting pituitary adenomas (GH pituitary adenoma).
Immunohistochemistry revealed nuclear immunoreactivity for p53 in 3/7 patients and nuclear immunoreactivity for Cyclin D1 in 2/7 patients. Immunostaining of ß-catenin showed nuclear,
DOI:10.4158/EP161580.OR c 2016 AACE.
cytoplasm and membrane immunoreactivity (2/7 patients) or merely cytoplasm immunoactivity (1/7 patients). The adrenocortical carcinoma showed positive staining for both p53 and Cyclin D1, and a high Ki-67 index of 60%. Mutations p.Lys177Argfs*19 and p.Asp287Val of AIP gene were identified in PASATs of the two patients with concomitant presence of GH pituitary adenoma. Conclusions: Clinical features of PASATs vary with gender and age of the patients. Abnormal p53 and ß-catenin expression might be involved in the tumorigenesis of these tumors. AIP mutations might be responsible for the concomitant presence of PASATs and GH pituitary adenoma.
Abbreviations:
PASATs = Pure androgen-secreting adrenal tumors; AIP = Aryl hydrocarbon receptor-interacting protein; GH pituitary adenoma = growth hormone-secreting pituitary adenomas; ACA = adrenocortical adenoma; ACC = adrenocortical carcinoma; DHEAS = Dehydroepiandrosterone sulfate.
Introduction:
Benign and malignant tumors of the adrenal cortex can be functional or non-functional, and most tumors are benign, non-functional adenomas which, mostly, are detected accidently. Functional tumors may produce steroid hormones, such as cortisol, aldosterone, or less commonly, androgens or estrogens. Pure androgen-secreting adrenal tumors (PASATs) are extremely rare,
most reports involving only a single case 1-4). Recent studies revealed that development of aldosterone- or cortisol-producing adrenal tumors might be related to somatic gene mutations [5].
However, the pathogenesis of PASATs have not been fully understood, partially because it is a DOI:10.4158/EP161580.OR C 2016 AACE.
rare condition. This study examined 9 cases of PASAT with an attempt to characterize its clinical features and to explore their possible pathogenesis.
Methods :
Patients:
We retrospectively reviewed the clinical data of 9 patients diagnosed with PASAT in Peking Union Medical College Hospital from 2002 to 2015. Clinical history, adrenal hormone levels before and after operation, results of imaging and pathological examinations were meticulously collected. The study was approved by the local ethical committee and informed consent was obtained from individual patients.
Immunohistochemistry:
Paraffin-embedded tumor tissues were available in 7 out of 9 patients, including recurrent adrenal tumor from one patient. Immunostaining for Ki-67, B-catenin, p53 and Cyclin D1 were detected in the tumors and normal adrenal cortex tissues. Immunohistochemical detection was conducted by using En Vision ™ Detection Kit (Dako). The antibodies and dilutions were as follows: Ki-67 (1:500; OriGene), ß-catenin (1:300; OriGene), p53 (1:400; Leica Biosystems) and Cyclin D1 (1:500; Roche). ß-catenin expression was deemed negative if only membrane was stained, which is found in normal adrenocortical cells, and was seen as positive when cytoplasm and nuclei were stained. Cyclin D1 expression was considered to be positive if >20% nuclei were stained and was taken as negative if only 0-20% nuclei were staining 6). Tumors were classified as
p53-negative when only few cells were weakly or no cells were stained and as p53- positive when nuclei were diffusely and intensely stained [7].
Mutational Analysis
Aryl hydrocarbon receptor-interacting protein (AIP, NM_003977) were directly sequenced by using genomic DNA extracted from formalin-fixed paraffin-embedded tissues (QIAGEN, Germany) according to the manufacturer’s protocols. Nest PCR was performed to amplify the AIP gene. The sequences of PCR primers used are shown in Table 1. The first PCR was carried out in a tube containing 40 ul of a reaction buffer made up of the following components: 50 ng of each outside primer, a 200 µM of each dNTP, 2.5 U of rTaq DNA polymerase (TAKARA, Japan), and 2×GC PCR buffer containing 1.5 mM MgCl2. The thermocycler (ABI2720) was programmed for 10 min at 95℃, followed by 40 cycles consisting of 94℃ for 30 sec, 55℃ for 30 sec, and 72℃ for 30 sec. The final extension was at 72 for 10 min. Second-round PCRs were performed with the inside primers under the same condition. Amplified products were detected by agarose gel electrophoresis and bi-directionally sequenced on an ABI3730 DNA Analyzer (Applied Biosystems). To predict the functional effects of novel mutations, the sequence alterations were assessed by the in silico prediction algorithms Polyphen-2 (http://genetics.bwh.harvard.edu/pph2/), SIFT (http://sift.jcvi.org/www/SIFT_seq_submit2.html), PROVEAN (http://provean.jcvi.org/protein_batch_submit.php?species=human) and MutationTaster (an online program at http://www.mutationtaster.org/), which, for any variation, automatically provides an estimated probability of being a pathogenic mutation or a benign variant.
DOI:10.4158/EP161580.OR c 2016 AACE.
Results:
Clinical Features of the patients:
Demographics data are summarized in Table 2. The onset age in the series ranged from 3.5 to 64 years old with a female domination. Virilization signs were present in all the 8 female patients (8 had hirsutism, 6 acne, 5 deepening of the voice, 4 clitoral enlargement and 3 Adam’s apple). In addition, two pre-puberty patients (Patient 2, 3) presented with sexual precocity, including appearance of public hair, growth spurt, advancement in bone age. And five patients (Patient 4-8) whose onset was at puberty or adulthood suffered from irregular menstruation or amenorrhoea. A
7 year-old male patient (Patient 1) presented with sexual precocity characterized by penis enlargement, appearance of public hair, acne, growth spurt and advancement of bone age to 14 year-old.
In all the patients, testosterone level was elevated (Table 2), while serum cortisol, 24-hour urinary free cortisol and plasma adrenocorticotropic hormone were within normal ranges. All the patients were normotensive and some patients were tested for 24-hour urinary catecholamine, plasma renin activity and aldosterone, which were also in normal ranges (Table 3). In all patients, the increased testosterone could not be suppressed after medium-dose dexamethasone suppression test (0.75 mg q6h). CT scan revealed unilateral adrenal mass (located at the left in 3 cases, at the right in 5 cases) in all but one patient (Patient 6), who had bilateral masses. All female patients were ultrasonographically evaluated for ovarian morphology and no abnormalities were detected.
Based on the above results, diagnosis of PASATs was established for all the patients. All patients underwent adrenalectomy. Patient 6, who had bilateral adrenal tumors, had only right adrenal mass removed. The patients were pathohistologically diagnosed as adrenocortical adenoma (ACA) in all but one (Patient 9), who was diagnosed as adrenocortical carcinoma (ACC). The Weiss scores [8] of the tumors are listed in Table 4.
The hormone levels were revaluated postoperatively in all patients but one. Testosterone level decreased dramatically to normal range in all female patients, while in the 7 year-old boy, the hormone dropped to 4.1 nmol/L. GnRH stimulation test verified that he had central precocious puberty probably due to an advanced bone age. Then the boy received GnRH analogue therapy (Leuprorelin 3.75mg subcutaneous injection per month). His Testosterone decreased to 0.3 nmol/L. Dehydroepiandrosterone sulfate (DHEAS) was measured in three patients, which increased (16155-38110 µg/1, normal range: 230-2660 µg/l) preoperatively, and decreased to normal range postoperatively. All the female patients showed remission of virilization during the follow-up. In one patient (Patient 8), five years after the operation, the tumor recurred locally, with testosterone increasing to 5.45 nmol/L and DHEAS to 12470 µg/1. She received a second surgery and achieved remission. Patient 9 was found to have multiple lung metastases soon after the operation, and was given mitotane for three months but she failed to respond to the treatment. She refused our recommendation for chemotherapy and merely received palliative treatment.
Two patients (Patient 5, 6) had both PASATs and growth hormone-secreting pituitary adenomas (GH pituitary adenoma). Patient 5 presented with increased statural growth and
DOI:10.4158/EP161580.OR c 2016 AACE.
enlarged body parts at the age of 13 years. Her height was 188 cm and weight was 138 kg at 15, with coarse facial features. All glucose suppressed GH values were >50 µg/1, serum prolactin was 6.0 ng/ml, and magnetic resonance imaging (MRI) revealed a pituitary macroadenoma of 3 cm*2.6 cm. She received debulking pituitary surgery plus postoperative radiotherapy. The patient developed hirsutism and amenorrhoea at the age of 17. When she was 23, she was diagnosed as having PASAT and received adrenalectomy. The patient died of radiation encephalopathy at 25. Patient 6 presented with progressive tall stature since age of 8. Her height was 170 cm at 14. When she was 20, she had deepening of the voice, excessive hair growth, amenorrhoea and muscularity. And when she was 25 years old, she was 192 cm in height and 140 kg in weight. She also presented with enlarged hands and feet, increased thickness of the skin and lip, protrusion of mandible, brow ridge and forehead at that time. The patient was referred to our hospital when she was 34. Nadir serum GH during oral glucose loading was 1.2 µg/1, serum prolactin was 1.6 ng/ml and MRI showed partially empty enlarged sella, suggesting prior attacks of pituitary apoplexy. CT showed bilateral adrenal adenomas, with the left one being 3*3 cm and the right one 5*4 cm. The patient was diagnosed with acromegalic gigantism caused by GH pituitary adenoma and PASATs. She received right adrenalectomy, and her testosterone level returned to normal.
Immunohistochemistry:
Immunohistochemical detection revealed nuclear immunoreactivity for p53 in 3/7 patients and nuclear immunoreactivity for Cyclin D1 in 2/7 patients. Normal adrenal cortices were negative for these two proteins. The ACC tissue (Patient 9) showed positive staining for both p53
DOI:10.4158/EP161580.OR c 2016 AACE.
and Cyclin D1, and a high Ki-67 index of 60%. Immunostaining of ß-catenin showed nuclear, cytoplasm and membrane immunoreactivity (2/7 patients) or merely cytoplasm immunoactivity (1/7 patients). Other tumors and normal adrenal cortices only showed membrane staining for B-catenin. The tumor from one patient (Patient 2) showed abnormal staining for all of the three protein and with a high Ki-67 index (10%). The Ki-67 index showed a tendency of increase in the recurrent tumor (3%), as compared to the primary tumor (1%) in patient 8. (Table 4, Fig. 1)
Sequencing of AIP genes:
To clarify whether the concomitant presence of PASATs and GH pituitary adenoma was related to AIP gene mutation, we sequenced AIP gene, and identified c.528delA (p.Lys177Argfs*19) and c.A860T (p.Asp287Val) mutations in the adrenal tumors of patients 5 and patient 6, respectively (Fig. 2). All the novel mutations were predicted to be pathogenic mutations (Table 5). We also screened AIP gene mutations in other adrenal tumors (including 9 non-functional adrenocortical adenoma and 6 cortisol-producing adenoma) and did not find any AIP mutations in these tumors.
Discussion:
PASATs were extremely rare. In a French study involving 801 adrenal operations, 21 patients (2.4%) were diagnosed as having PASATs [8] In our study, 6/9 patients had onset during their childhood (under 18 years old), and 8/9 patients were female. Epidemiological data suggested that adrenocortical tumors assume a bimodal age distribution, with peaks occurring in
DOI:10.4158/EP161580.OR c 2016 AACE.
the first and fourth to fifth decade of life, and are more common in girls than in boys, with a ratio of 2.5:1 [9]. Contrast to adult patients, children with adrenocortical tumors often have hypersecretion of adrenal hormones (androgen, cortisol, rarely, aldosterone). A Brazilian study, including 58 patients with childhood adrenocortical tumors (aged from 3 days to 15.7 yr), found that 40% of their patients merely presented with virilization, with isolated Cushing’ syndrome accounting for only 3%, and more patients (50%) had both virilization and Cushing’s syndrome [10] .
PASATs can cause hirsutism and virilization in 90-100% of such patients and amenorrhea in 40-60% [11] Clinical features of PASATs vary with gender and age of the patients. In female patients with onset at puberty or adulthood, virilization signs, including hirsutism, acne, irregular menstruation or amenorrhoea, deepening of the voice and atrophy of breast and uterus, are conspicuous. On the other hand, pre-puberty patients may present with sexual precocity, including appearance of pubic hair, growth spurt, advancement in bone age, which might easily draw attention. Suspicious patients are recommended to be tested for sex hormones, including serum testosterone, DHEAS, or even serum testosterone after medium-dose dexamethasone suppression test, and to receive adrenal imaging examinations. Other causes of hyperandrogenism, such as polycystic ovary syndrome and congenital adrenal hyperplasia, should be considered and, if necessary, excluded. Of note, there were no male adults in our series. Unlike pediatric or female patients with PASAT, their male adult counterparts may not have any clinical signs, which might
cause missed diagnosis of this condition. For those patients with an elevated level of DHEAS, possibility of PASAT should be considered [12]
The pathogenesis of PASATs are largely unknown. Overexpression of 3-hydroxysteroid dehydrogenase 2 (3ß-HSD) and cytochrome P450 17a-hydroxylase (CYP17) were found in patients with PASATs. Such over-expression can result in increased enzymatic activities, thereby driving the synthesis towards androgen production [13].
Till now, except one report, which found over-expression of p53 in two of four PASATs [14], no other studies explored the tumorigenesis of PASATs. In this study, we found that not only p53, but also ß-catenin and Cyclin D1 was abnormally over-expressed in some PASATs. ß-catenin can stimulate proliferation of adrenocortical cells during embryonic development and plays a role in cell renewal in adult adrenal cortex [15]. Wnt/ß-catenin tends to be dysregulated in sporadic adrenocortical tumors. It was reported that approximately 24-40% of ACAs, including aldosterone and cortisol-producing adenomas, and 30-80% of ACCs had abnormal intracellular accumulation of ß-catenin [6]. In our study, 3/7 PASATs patients showed abnormal ß-catenin accumulation, suggesting that ß-catenin might be implicated in the pathogenesis of PASATs. Mutation of p53 and subsequent accumulation of p53 protein have been believed to bear relationship with malignant transformation of adrenocortical cells, which occur more frequently in ACCs than in ACAs [7, 16] In our study, one ACCs patient and two ACAs patients had both relatively high Weiss score and abnormal nuclear accumulation of p53 protein, and the ACC patient and one ACAs patient also had high Ki-67 index and increased Cyclin D1 expression, suggesting that p53
DOI:10.4158/EP161580.OR c 2016 AACE.
abnormality might be related to malignant tendency of PASATs. This study preliminarily demonstrated that the pathogenesis of PASATs, similar to other adrenal adrenomas, involves B-catenin and p53 dysregulation.
Interestingly, two patients in our study had both adrenocortical tumor and pituitary adenoma, which is very rare. Heterozygous germline mutations of AIP gene lead to both familial isolated pituitary adenoma, usually in the form of GH pituitary adenoma and prolactinomas, and sporadic pituitary adenoma. AIP mutations account for approximately 50% of familial isolated GH pituitary adenoma [17,18] Only two studies reported that AIP mutations might also be related to adrenocortical tumors [18,19] Cazabat et al. described a patient with a germline AIP mutation (p.Lys201X) who was diagnosed as having acromegaly at age of 27, and incidental non-hypersecreting adrenocortical adenoma at 41 [19]. Toledo et al. reported a familial GH pituitary adenoma with germline R81X mutation in AIP gene. The index patient was diagnosed with acromegaly due to a pituitary macroadenoma at 25, and developed PASAT-related virilization and secondary amenorrhea 13 years later[18] Since AIP interacts with phosphodiesterases type 4A (PDE4A) and type 2A (PDE2A) , it may affect the cyclic AMP (cAMP) signaling cascade, a cellular pathway which is believed to be dysregulated in the tumor development of pituitary and adrenal glands[18] In this study, AIP mutations were identified in the adrenal tumors of two patients concomitantly having PASATs and GH pituitary adenoma, suggesting that AIP-related cAMP pathway plays an important role in the androgen synthesis and tumorigenesis of PASATs. Further studies are needed to clarify whether AIP-related adrenal
DOI:10.4158/EP161580.OR c 2016 AACE.
tumors produce androgen rather than other adrenal hormones, or it happened to be the case in our series. Since blood samples or other tissues of the patients were not available, whether AIP mutations detected in our patients were somatic or germline mutation could not be determined. In light of the early onset of GH pituitary adenoma in the two patients, germline mutation of AIP was more likely.
In conclusion, we presented the clinical features of 9 cases of PASATs and found that abnormal p53 and ß-catenin expression might be involved in the tumorigenesis of these tumors. AIP mutations, which disrupt cAMP pathway, might be responsible for the concomitant presence of PASATs and GH pituitary adenoma.
Funding: This work was supported by research grants from the National Key Program of Clinical Science of China (No. WBYZ2011-873).
Disclosure statement: The authors have nothing to disclose.
Authorship:
Tong al performed the research and wrote the paper. Jiang J and Zhang YS contributed the gene analysis. Wang F and Li CY performed the immunohistochemistry. Wu XY designed the research study and revised the paper.
Reference
DOI:10.4158/EP161580.OR c 2016 AACE.
1. Bonfig W, Bittmann I, Bechtold S, et al. Virilising adrenocortical tumours in children. Eur J Pediatr 2003;162:623-8.
2. Pal DK, Kundu AK, Chakrabortty S, Das S. Virilising adrenocortical carcinoma. J Indian Med Assoc 2002;100:251-2.
3. . Salt AT, Savage MO, Grant DB. Growth patterns after surgery for virilising adrenocortical adenoma. Arch Dis Child 1992;67:234-6.
4. Honour JW, Price DA, Taylor NF, Marsden HB, Grant DB. Steroid biochemistry of virilising adrenal tumours in childhood. Eur J Pediatr 1984;142:165-9.
5. Faillot S, Assie G. ENDOCRINE TUMOURS: The genomics of adrenocortical tumors. Eur J Endocrinol 2016;174:R249-65.
6. Mitsui Y, Yasumoto H, Nagami T, et al. Extracellular activation of Wnt signaling through epigenetic dysregulation of Wnt inhibitory factor-1 (Wif-1) is associated with pathogenesis of adrenocortical tumor. Oncotarget 2014;5:2198-207.
7. . Sredni ST, Zerbini MC, Latorre MR, Alves VA. p53 as a prognostic factor in adrenocortical tumors of adults and children. Braz J Med Biol Res 2003;36:23-7.
8. Moreno S, Montoya G, Armstrong J, et al. Profile and outcome of pure androgen-secreting adrenal tumors in women: experience of 21 cases. Surgery 2004;136:1192-8.
9. Cho MJ, Kim DY, Kim SC, Kim TH, Kim IK. Adrenocortical tumors in children 18 years old and younger. J Korean Surg Soc 2012;82:246-50.
10. Sandrini R, Ribeiro RC, DeLacerda L. Childhood adrenocortical tumors. J Clin Endocrinol Metab 1997;82:2027-31.
11. Rodriguez-Gutierrez R, Bautista-Medina MA, Teniente-Sanchez AE, Zapata-Rivera MA, Montes-Villarreal J. Pure androgen-secreting adrenal adenoma associated with resistant hypertension. Case Rep Endocrinol 2013;2013:356086.
12. Ghayee HK, Rege J, Watumull LM, et al. Clinical, biochemical, and molecular characterization of macronodular adrenocortical hyperplasia of the zona reticularis: a new syndrome. J Clin Endocrinol Metab 2011; 96:E243-50.
13. Yang G, Dou J, Zhang X, et al. Increased 3beta-hydroxysteroid dehydrogenase 2 and 17alpha-hydroxylase activities in a virilized adolescent female with adrenal adenoma: A case report. Exp Ther Med 2016;11:530-4.
14. Bonfig W, Bittmann I, Bechtold S, et al. Virilising adrenocortical tumours in children. Eur J Pediatr 2003;162:623-8.
15. Bonnet S, Gaujoux S, Launay P, et al. Wnt/beta-catenin pathway activation in adrenocortical adenomas is frequently due to somatic CTNNB1-activating mutations, which are associated with larger and nonsecreting tumors: a study in cortisol-secreting and -nonsecreting tumors. J Clin Endocrinol Metab 2011;96:E419-26.
16. Wasserman JD, Zambetti GP, Malkin D. Towards an understanding of the role of p53 in adrenocortical carcinogenesis. Mol Cell Endocrinol 2012;351:101-10.
17. Beckers A, Aaltonen LA, Daly AF, Karhu A. Familial isolated pituitary adenomas (FIPA) and the pituitary adenoma predisposition due to mutations in the aryl hydrocarbon receptor interacting protein (AIP) gene. Endocr Rev 2013;34:239-77.
18. Toledo RA, Mendonca BB, Fragoso MC, et al. Isolated familial somatotropinoma: 11q13-loh and gene/protein expression analysis suggests a possible involvement of aip also in non-pituitary tumorigenesis. Clinics (Sao Paulo) 2010;65:407-15.
19. Cazabat L, Libe R, Perlemoine K, et al. Germline inactivating mutations of the aryl hydrocarbon receptor-interacting protein gene in a large cohort of sporadic acromegaly: mutations are found in a subset of young patients with macroadenomas. Eur J Endocrinol 2007;157:1-8.
Figure legends:
Figure 1 Immunostaining for ß-catenin, p53, Cyclin D1 and Ki-67 in PASATs and normal adrenal cortex tissues (X200).
Figure 2 Sequencing of tumor DNA showed the AIP c.528delA (p.Lys177Argfs*19) and c.A860T (p.Asp287Val) mutations in the adrenal tumors of patients 5 and patient 6, respectively.
ß - catenin
Patient2
Patient3
Patient5
Patient6
Patient9
Normal adrenal cortex
C
Patient 5 AGAAGGCAAGGGCA TT CCCCC TTT c.528delA(p.Lys177Argfs*19)
Patient 6 G CC CAG G CTG ACT TTG CCAAAGT c.A860T(p.Asp287Val)
| Exon | Nest PCR | Forward primer(5'-3') | Reverse primer(3'-5') | Product size (bp) |
|---|---|---|---|---|
| 1 | 1 | CACGCTCAGTCCCTTTTG | TTAAATTCAGCCCAATCAGC | 397 |
| 2 | AAGCTACCGAGCGAGTCC | TCTCGCCTAAGGCCTCC | 226 | |
| 2 | 1 | GGATGAAGCCAGGTGTAAG | CTGAGATCGTACCACTGC | 495 |
| 2A | GGTCAGGGTGAGGGTTTG | TAGGGCTTGGCTGGACA | 276 | |
| 2B | GACTTCTCCTTGGGGGTCA | CCCTGGGGATAGGGAAT | 312 | |
| 3 | 1 | AATTAAAAGCCTCCTGTGCT | TTCTTGTCTCTGTCCGCT | 479 |
| 2 | TTGTGGACCCGGTGACC | CTGGGTGGACAGGCCA | 328 | |
| 4 | 1 | TGTTTGATGCTTTTTGAGTG | GGGAGAAGCTGTAGACCTG | 403 |
| 2A | AGCCCCGCTGTGATATG | CCCTGGCTCCACACCC | 263 | |
| 2B | GCCCCGCTGTGATATG | CCACACCCCCCTCCAT | 254 | |
| 5 | 1 | CCAAGTACTACGATGCCATT | TTGTGAAAGGCTAGGTCTTG | 384 |
| 2 | AGGGGGGTGTGGAGCC | GACCCCAGCAGTGACAGG | 284 | |
| 6 | 1 | GCCAATGAAGCATGAATGG | AGCTCAGCAGACTCAGAG | 500 |
| 2A | CCATGGTGCCAGGAGAC | GACGCAGCACGGGCA | 369 | |
| 2B | CCTCATGCCCTTGCATG | TGGGCTTGGCAGGTAAG | 286 |
| Patient | Sex | Age at diagnosis (y.o.) | Course (years) | Preoperation | Postoperation | Tumor size(cm) | Pathologic diagnosis | Follow-up | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| T (nmol/L) | FSH (IU/L) | LH (IU/L) | E2 (pmol/L) | T (nmol/L) | FSH (IU/L) | LH (IU/L) | E2 (pmol/L) | After operation (years) | condition | ||||||
| P1 | M | 7 | 3 | 7.6 | 3.0 | 0.5 | 69.7 | 4.1 | 2.5 | 1.4 | 61.7 | 5.2 | ACA | 4 | No recurrence |
| P2 | F | 5 | 1.5 | 12.2 | 0.2 | 0.1 | 94.5 | 0.6 | 6.5 | 1.9 | 170.0 | 5.0 | ACA | 1 | No recurrence |
| P3 | F | 6 | 2 | 8.2 | 0.2 | 0.2 | 40.0 | 0.1 | 3.7 | 4.8 | 82.0 | 2.0 | ACA | 1 | No recurrence |
| P4 | F | 20 | 4 | 52.3 | 0.1 | 0.1 | 32.0 | ND | ND | ND | ND | 10.0 | ACA | lost | |
| P5 | F | 23 | 6 | 4.1 | 5.1 | 2.5 | 209.8 | 0.2 | 6.4 | 3.5 | 35.4 | 3.0 | ACA | 2 | Die of radiation encephalopathy |
| P6 | F | 34 | 14 | 6.3 | 0.3 | 0.2 | 323.3 | 0.7 | 0.1 | 0.1 | 115.5 | 5.0 | ACA | lost | |
| P7 | F | 40 | 9 | 5.4 | 2.9 | 2.8 | 282.2 | 1.3 | 10.5 | 23.8 | 626.1 | 4.0 | ACA | 1 | No recurrence |
| P8 | F | 44 | 30 | 33.0 | 0.1 | 0.2 | 52.1 | 0.8 | 59.1 | 28.7 | 20.2 | 9.0 | ACA | 5 | Local recurrence |
| P9 | F | 66 | 2 | 8.8 | 29.2 | 10.3 | 33.3 | 0.8 | 51.0 | 21.2 | 84.4 | 15.0 | ACC | 2 | Multiple lung metastasis |
ACA: adrenocortical adenoma; ACC: adrenocortical carcinoma; ND: not detected
| 17-alpha | Hypothalamus-pituitary-adrenal axis | Renin-angiotensin-aldosterone | ||||
|---|---|---|---|---|---|---|
| hydroxyprogesterone (ng/ml) | Urinary free cortisol (ug/24h) | Cortisol (ug/dl) | Corticotropin (pg/ml) | Plasma renin activity (ng/ml/h) | Aldosterone (ng/dl) | |
| Normal | 0.3-2.2 | 12.3-103.5 | 4.0-22.3 | 0-46.0 | 0.93-6.56 | 6.5-15.0 |
| Range | ||||||
| P1 | 1.0 | 23.1 | 4.1 | ND | ND | ND |
| P2 | 7.8 | 48.5 | ND | 16.4 | ND | ND |
| P3 | 1.1 | 9.1 | 13.2 | 12.9 | ND | ND |
| P4 | 5.0 | 37.1 | 17.2 | 12.1 | ND | ND |
| P5 | 1.9 | 15.1 | 14.2 | 21.1 | ND | ND |
| P6 | 5.0 | 47.2 | 19.3 | 19.6 | ND | ND |
| P7 | 1.8 | 30.6 | 11.1 | 19.3 | 0.2 | 7 |
| P8 | 3.2 | 71.8 | 14.9 | 20.2 | 1.23 | 15.5 |
| P9 | 4.0 | 68.8 | 14.1 | 32.3 | 1.32 | 14.1 |
ND: not determined
| Tissue | Weiss score | ß-caterin | p53 | CyclinD1 | Ki-67 |
|---|---|---|---|---|---|
| P2 | 3 | Positive staining in nuclear, cytoplasma and membrane | Nuclear positive | Nuclear positive | 10% |
| P3 | 3 | M | Nuclear positive | - | <1% |
| P4 | 1 | M | - | <1% | |
| P5 | 1 | Positive staining in nuclear, cytoplasma and membrane | - | - | <1% |
| P6 | 1 | Positive staining in cytoplasma | - | - | 1% |
| P8 | 3 | M | - | - | <1% |
| P8 Recurrence | 4 | M | - | - | 3% |
| P9 | 5 | M | Nuclear positive | Nuclear positive | 60% |
| N1 | M | - | - | <1% | |
| N2 | M | - | - | <1% | |
| N3 | M | - | - | <1% | |
| N4 | M | - | - | <1% | |
| N5 | M | - | - | <1% | |
| N6 | M | - | - | <1% |
P: tumor from patient; N: normal adrenal cortex tissue; M: membrane positive staining; - negative staining
| Gene | Gene mutation | Bioinformatics analysis | |||||||
|---|---|---|---|---|---|---|---|---|---|
| PolyPhen2 | Mutation Taster | SIFT | PROVEAN | ||||||
| prediction | Score | prediction | Score | prediction | Score | prediction | Score | ||
| AIP | c.A860T, p.Asp287Val | Probably damaging | 0.999 | disease causing | 0.999 | Damaging | 0.000 | deleterious | -8.08 |
| AIP | c.528delA p.Lys177Argfs*19 | - | - | disease causing | 1.000 | - | - | - | - |
PolyPhen Prediction Score: score>0.5 probably damaging;
Mutation Taster Prediction: polymorphism or disease causing SIFT PREDICTION (tolerated or damaging): score<0.05 damaging;
PROVEAN PREDICTION(deleterious or neutral): score ← 2.5 deleterious