CrossMark
RESEARCH LETTER
Palbociclib inhibits proliferation of human adrenocortical tumor cells
Chiara Fiorentini1 . Martina Fragni1 . Guido A. M. Tiberio2 . Diego Galli1 .
Elisa Roca3 . Valentina Salvi4 . Daniela Bosisio4 . Cristina Missale1 .
Massimo Terzolo5 · Maurizio Memo1 · Alfredo Berruti3 · Sandra Sigala1
Received: 24 October 2016 / Accepted: 18 February 2017 @ Springer Science+Business Media New York 2017
Introduction
Adrenocortical cancer (ACC) is a rare malignant tumor [1]. Pharmacological therapy is based on mitotane administered alone or in association with the EDP regimen (etoposide, doxorubicin, and cisplatin) [1]. However, the prognosis of ACC patients not amenable to surgery still remains poor and newer treatment strategies are needed [2]. Drugs tar- geting cell cycle could be a relevant new therapeutic approach for patients with advanced ACC [3].
Cell cycle is controlled by several key proteins, including CDKs (cyclin-dependent kinases), which are the target of recently discovered cell-cycle checkpoint inhibitors [4]. Palbociclib is a CDK4/6-inhibitor that is active against a
Chiara Fiorentini and Martina Fragni equally contributed to this work
☒ Alfredo Berruti alfredo.berruti@gmail.com
1 Section of Pharmacology, Department of Molecular and Translational Medicine, University of Brescia, V.le Europa 11, 25123 Brescia, Italy
2 Surgical Clinic, Department of Clinical and Experimental Sciences, University of Brescia at Asst Spedali Civili di Brescia, P.le Spedali Civili 1, 25123 Brescia, Italy
3 Oncology Unit, Department of Medical and Surgical Specialties, Radiological Sciences, and Public Health, University of Brescia at Asst Spedali Civili di Brescia, P.le Spedali Civili 1, 25123 Brescia, Italy
4 Section of Oncology and Experimental Immunology, Department of Molecular and Translational Medicine, University of Brescia, V.le Europa 11, 25123 Brescia, Italy
5 Internal Medicine 1, Department of Clinical and Biological Sciences, University of Turin at San Luigi Hospital, Regione Gonzole 10, 10043 Orbassano, Italy
broad range of tumors and has an acceptable toxicity, being neutropenia being the most relevant side effect [5]. This drug is actually approved in the management of locally advanced or metastatic breast cancer [6]
In this study, we investigated in vitro the effect of Pal- bociclib in NCI-H295R ACC cells and human ACC pri- mary cultures.
Methods
Cell line
NCI-H295R cell line was obtained from the American Type Culture Collection (ATCC) and cultured as suggested.
Primary cell cultures
Human ACC primary cells were derived from surgical specimens of ACC patients after obtaining a written informed consent. They were identified by a sequential number, based on the date of surgery. The project was approved by the local Ethical Committee. ACC02 cell culture derived from a steroid-secreting ACC; whereas ACC03, ACC06, and ACC08 cell cultures derived from non-secreting ACC. After surgical removal, cells were enzymatically digested with collagenase and cultured in the same medium of NCI-H295R cells.
Quantitative RT-PCR (qRT-PCR)
Gene expression was evaluated by qRT-PCR (ViiA7, Applied Biosystems), using the SYBR Green as
fluorochrome, as described [7]. Primer sequences are shown in Fig. 1 (panel A).
Cell viability assay
ACC cells were treated up to for 4 days with palbociclib (1 nM-1 µM), solubilized in water. Cell viability was determined by 3-(4,5-Dimethyl-2-thiazol)-2,5-diphenyl-2H- tetrazolium bromide (MTT) dye reduction assay [8]. Absorbance was determined by a spectrophotometer at 540/ 620 nm (GDV).
Cell cycle analysis
Flow cytometric cell cycle analysis was performed as described [9]. Untreated and treated-NCI-H295R cells were fixed, treated with RNase A (12.5 µg/ml), stained with Propidium iodide (40 µg/ml) and analyzed by Flow Cyto- metry using a MACS Quant Analyzer (Miltenyi Biotec GmbH) for cell cycle status. Data were analyzed using FlowJo (TreeStar).
Western blot
ACC cell lysates were processed as described [8]. The following primary antibodies were used: Rb protein (pRB) (DB Pharmigen; 2.5 µg/mL), CDK4 or CDK6 kinase (Santa Cruz Biotechnologies; both at 1 ug/mL), cyclin D1 (Cell Signalling; 0.1 µg/mL), p107 and p130 (Santa Cruz Bio- technologies, both at 1 µg/mL) and tubulin (Sigma Aldrich; 0.01 µg/mL). The specific signal was visualized and the densitometric analysis was performed using the GelPro- Analyzer version 6.0 (MediaCybernetics).
Statistical analysis
Data analysis was conducted using GraphPad Prism 5 soft- ware (GraphPad Software). Statistical analysis was carried out using one-way ANOVA and Bonferroni’s Multiple Comparison test. A p value < 0.05 was considered as sta- tistically significant.
Results
CDK 4/6 and Rb protein (pRb) expression
The mRNAs encoding for CDK4/6 and pRb were examined in both NCI-H295R cells and ACC primary cultures using qRT-PCR. Differences in the threshold cycle (Ct) value between the ß-actin housekeeping gene and CDK4, CDK6 and Rb genes (ACt) were calculated, as an index of the amount of mRNA expressed. Both NCI-H295R cells and
ACC primary cultures expressed high amount of mRNA encoding CDK4/6. pRb mRNA was highly detected in ACC primary cultures while it was almost undetectable in NCI-H295R cells (Fig. 1a). CDK4, CDK6, and pRb were then analyzed by Western Blot, showing that both the CDK kinases were equally expressed. The ~106 KDa band, cor- responding to the predicted molecular weight of pRb, was detected in ACC02, ACC03, and ACC06 primary cells, but it was almost absent in NCI-H295R and ACC08 cells (Fig. 1b).
Effect of palbociclib on NCI-H295R cells and ACC primary cultures cell viability
The MTT assay revealed that Palbociclib induced a concentration-dependent decrease of cell viability in each cell culture (Fig. 1c).
Effect of palbociclib on NCI-H295R cell cycle
NCI-H295R cells were then treated with the Palbociclib IC50 and the cell cycle distribution was analyzed by flow cytometry at different times. Results indicated an increase in the proportion of cells at the G0/G1 phase after 48 h of treatment (untreated cells: 51.3% ± 1.5; Palbociclib-treated cells: 60.8% ±6.7), that was maintained at 72 h (untreated cells: 47.4% ± 0.2; Palbociclib-treated cells: 59.5% ± 5.1). Furthermore, Palbociclib significantly decreased the expression levels of the cell cycle-related proteins cyclin D1 (34% ±2.3 and 46% ±1.1 of reduction, at 48 and 72 h of treatment, respectively, p <0.001) (Fig. 1d), consistent with a G0/G1 cell cycle arrest [10]. CDK4/6 expression did not change after treatment both at mRNA and protein level of (data not shown). Interestingly, a ~130 kDa band, likely corresponding to the p130/RBL2 Rb-like family protein [11, 12], was clearly detected in NCI-H295R cells (Fig. 1e).
Discussion
This study explored for the first time the in vitro activity of the CDK4/6 antagonist Palbociclib in ACC, using the commercially available NCI-H295R cell line and primary cultures derived from ACC patients.
It is known that CDK4/6 inhibition by Palbociclib cor- relates with greater CDK4/6 inhibitor therapeutic activity, whereas the loss of RB1 is linked to CDK inhibitor resis- tance [4]. Inactivating mutations or homozygous deletions of the RB1 gene were found in 7% of ACC [13, 14], indi- cating that a small proportion of ACC may be potentially resistant to CDK4/6 inhibitors. In this study, while NCI- H295R cells and all the primary ACC cells expressed CDK4 and CDK6, pRb protein was found in 3 out of 4
a
| gene | Oligonucleotide Primers (5'-3') | NCI-H295R ACt | ACC02 ΔCt | ACC03 ACt | ACC6 ACt | ACC08 ACt |
|---|---|---|---|---|---|---|
| CDK4 | GCCTCGAGATGTATCCCTGC AGTCAGCATTTCCAGCAGCA | 3.39 ±0.13 | 3.68 ±0.02 | 4.95 ±0.10 | 3.65 ±0.07 | 6.26 ±0.05 |
| CDK6 | ATCTCTGGAGTGTTGGCTGC GGCAACATCTCTAGGCCAGTC | 4.54 ±0.18 | 6.14 ±0.10 | 8.23 ±0.08 | 9.43 ±0.15 | 10.18 ±0.05 |
| Rb | CCGTGTGCTCAAAAGAAGTGC AGTCATTTCTGCCAGTTTCTGCT | 12.19 ±0.99 | 5.96 ±0.07 | 7.38 ±0.04 | 6.21 ±0.01 | 9.03 ±0.10 |
| Reference gene: ß actin | TCTTCCAGCCTTTCCTTCCTG CAATCGCAGGGTACATGGTG | - | - | - | - | - |
b
C
120
106 kDa
pRb
Cell viability (% of ctrl)
100
-NCI-H295R
…- ACC02
40 kDa
CDK6
80
--- ACC03
..-.. ACC06
36 kDa
CDK4
60
---- ACC08
55 kDa
tubulin
40
1
2
3
4
5
20
0
0
-10
-9
-8
-7
-6
-5
palbociclib [Log(M)]
d
NCI-H295R cells
e
NCI-H295R cells
48h 72h
36 kDa
cyclin D1
130 kDa
p130
107 kDa
p107
55 kDa
tubulin
55 kDa
tubulin
Palbociclib
-
+
+
ACC primary cultures. In the ACC08, in fact, only the pRb transcript was clearly detected, suggesting the presence of a mutation in the translational mechanisms of this protein. In addition, both pRb mRNA and protein were hardly detected in NCI-H295R cells.
experiments, run in triplicate. NCI-H295R cell line, ACC03, ACC08, and ACC06: for concentrations starting from 250 nM to 1 µM, *p < 0.001 vs. untreated cells; ACC02: for concentrations starting from 500 nM to 750 nM, p <0.01 vs. untreated cells, and for 1 µM con- centration, *p <0.001 vs. untreated cells. IC50 value were: 0.84 uM (95% CI: 0.4-1.7) for NCI-H295R cells, 0.67 uM (95% CI: 0.66-0.69) for ACC02, 0.29 UM (95% CI: 0.15-0.57) for ACC03, 0.50 µM (95%
CI: 0.28-0.88) for ACC06, and 0.18 uM (95% CI: 0.10-0.32) for ACC08. d Cyclin D1 expression in untreated and Palbociclib-treated NCI-H295R cells. Cells were treated with palbocilcib and analyzed for cyclin D1 using Western Blot technique. The human a-tubulin was used as internal control. The specific signal was visualized by the ECL-PLUS system. e Analyses of p107/RBL1 and p130/RBL2 expression in NCI-H295R cells. Lysates from NCI-H295R cells were analyzed for p107/RBL1 and p130/RBL2 expression by using Western Blot technique. The human a-tubulin was used as internal control. The specific signal was visualized by the ECL-PLUS system
Palbociclib significantly affected cell viability in a concentration-dependent way in all ACC cells used in this study, although with a different sensitivity. Overall, the IC50 values obtained were close to the Cmax of about 51 ng/ml measured after one single dose of 125 mg Palbociclib in
humans [15], corresponding to 0.11 uM. Flow cytometric analysis revealed that Palbociclib treatment lead to cell accumulation in G0/G1 phase in NCI-H295R cells, com- bined with a significant decrease of cyclin D1 levels, while CDK4/6 expression was unchanged. These data confirm also in ACC cells that the cell cycle arrest is likely the main mechanism of the cytotoxic effect of Palbociclib [10].
Interestingly, despite the lack of pRb expression, both NCI-H295R cells and ACC08 primary culture were sensi- tive to the anti-tumoral effect of Palbociclib. It is well known that pRb is just one of the multiple targets of the CDK4/6/Cyclin D pathway [11] and a Rb-like family including p107/RBL1 and p130/RBL2 proteins (all sub- strates for CDK/6 inhibitors) was identified [12]. One of these proteins (p130/RBL2) was detected in NCI-H295R cells in this study. A recent study showed that pRb negative human hepatoma cell lines are sensitive to palbociclib due the expression of both p107/RBL1 and p130/RBL2 [16].
Several molecular targets have been recently identified for novel treatment approaches in the management of ACC, including mTOR [17, 18], Wnt-beta catenin signaling pathway [13], receptors for different growth factors and the ACAT1 [2] and CYP17A1 [19] steroidogenic enzymes.
In this study, we provide a preclinical preliminary evi- dence that CDK4/6 targeting agents could be effective in the ACC treatment, irrespective pRb expression. Palboci- clib, whose toxicity profile seems to be advantageous over the EDP regimen [20], deserves to be further explored as a new therapeutic option in ACC.
Acknowledgements This work was supported by University of Brescia local grants; AIRC, project IG17678; Fondazione Camillo Golgi and by a private donation of Mrs Serena Ambrogini and family in memory of her son Guido Cioni. M.F. was supported by a grant from the Italian Society of Pharmacology. Palbociclib was kindly provided by Pfizer.
Compliance with ethical standards
Conflict of interest The authors declare that they have no conflict of interest in relation to the topic of the manuscript.
Ethical approval The project was approved by the local Ethical Committee.
Informed consent Informed consent was obtained from all indivi- dual participants included in the study.
References
1. A. Berruti, E. Baudin, H. Gelderblom, H.R. Haak, F. Porpiglia, M. Fassnacht, G. Pentheroudakis, ESMO guidelines working group: adrenal cancer: esmo clinical practice guidelines for diagnosis, treatment and follow-up. Ann. Oncol. 23(Suppl 7), vii131-vii138 (2012)
2. A.O. Hoff, A. Berruti, Hormone and Cancer 5th International ACC Symposium: future and current therapeutic trials in adre- nocortical carcinoma. Horm. Cancer 7, 29-35 (2016)
3. M.C. De Martino, A. Al Ghuzlan, S. Aubert, G. Assié, J.Y. Scoazec, S. Leboulleux, C. Do Cao, R. Libè, C. Nozières, M. Lombès, F. Pattou, F. Borson-Chazot, S. Hescot, C. Mazoyer, J. Young, I. Borget, A. Colao, R. Pivonello, J.C. Soria, J. Bertherat, M. Schlumberger, L. Lacroix, E. Baudin, Molecular screening for a personalized treatment approach in advanced adrenocortical cancer. J. Clin. Endocrinol. Metab. 98, 4080-4088 (2013)
4. E. Hamilton, J. Infante, Targeting CDK4/6 in patients with cancer. Cancer Treat. Rev. 45, 129-138 (2016)
5. M.A. Dickson, Molecular pathways: CDK4 inhibitors for cancer therapy. Clin. Cancer Res. 20, 3379-3383 (2014)
6. S. Verma, C.H. Bartlett, P. Schnell, A.M. DeMichele, S. Loi, J. Ro, M. Colleoni, H. Iwata, N. Harbeck, M. Cristofanilli, K. Zhang, A. Thiele, N.C. Turner, H.S. Rugo,: Palbociclib in combination with fulvestrant in women with hormone receptor-positive/HER2-nega- tive advanced metastatic breast cancer: detailed safety analysis from a multicenter, randomized, placebo-controlled, phase III Study (PALOMA-3). Oncologist 21, 1165-1175 (2016)
7. S. Sigala, S. Bodei, C. Missale, D. Zani, C. Simeone, S.C. Cunico, P.F. Spano, Gene expression profile of prostate cancer cell lines: effect of nerve growth factor treatment. Mol. Cell. Endocrinol. 1284, 11-20 (2008)
8. F. Fiorentini, S. Bodei, F. Bedussi, M. Fragni, S.A. Bonini, C. Simeone, D. Zani, A. Berruti, C. Missale, M. Memo, P.F. Spano, S. Sigala,: GPNMB/OA protein increases the invasiveness of human metastatic prostate cancer cell lines DU145 and PC3 through MMP-2 and MMP-9 activity. Exp. Cell Res. 323, 100-111 (2014)
9. I. Casaburi, P. Avena, A. De Luca, A. Chimento, R. Sirianni, R. Malivindi, V. Rago, M. Fiorillo, F. Domanico, C. Campana, A.R. Cappello, F. Sotgia, M.P. Lisanti, V. Pezzi, Estrogen related receptor a (ERRa) a promising target for the therapy of adreno- cortical carcinoma (ACC). Oncotarget 22, 25135-25148 (2015)
10. R. Roskoski, Cyclin-dependent protein kinase inhibitors including palbociclib as anticancer drugs. Pharmacol. Res. 107, 249-275 (2016)
11. N.J. Dyson, RB1: a prototype tumor suppressor and an enigma. Genes Dev. 30, 1492-1502 (2016)
12. M. Malumbres, M. Barbacid, Mammalian cyclin-dependent kinases. Trends Biochem. Sci. 30, 630-641 (2005)
13. G. Assié, E. Letouzé, M. Fassnacht, A. Jouinot, W. Luscap, O. Barreau, H. Omeiri, S. Rodriguez, K. Perlemoine, F. René- Corail, N. Elarouci, S. Sbiera, M. Kroiss, B. Allolio, J. Wald- mann, M. Quinkler, M. Mannelli, F. Mantero, T. Papathomas, R. De Krijger, A. Tabarin, V. Kerlan, E. Baudin, F. Tissier, B. Dousset, L. Groussin, L. Amar, E. Clauser, X. Bertagna, B. Ragazzon, F. Beuschlein, R. Libé, A. de Reyniès, J. Bertherat, Integrated genomic characterization of adrenocortical carcinoma. Nat. Genet. 46, 607-612 (2014)
14. B. Ragazzon, R. Libé, G. Assié, F. Tissier, O. Barreau, C. Houdayer, K. Perlemoine, A. Audebourg, E. Clauser, F. René- Corail, X. Bertagna, B. Dousset, J. Bertherat, L. Groussin, Mass- array screening of frequent mutations in cancers reveals RB1 alterations in aggressive adrenocortical carcinomas. Eur. J. Endocrinol. 170, 385-391 (2014)
15. J.T. Hoffman, A. Plotka, M. O’Gorman, A. Chang, M. Kosa, C.M. Loi, C. Gallo-Stampino, D.D. Wang,: A phase 1 rando- mized, open-label, fixed-sequence, 2-period study of the effect of multiple doses of rifampin on palbociclib (PD-0332991) phar- macokinetics in healthy volunteers. ASCO Annual Meeting, Philadelphia, 18-22, (2015)
16. D.B. Rivadeneira, C.N. Mayhew, C. Thangavel, E. Sotillo, C.A. Reed, X. Graña, E.S. Knudsen, Proliferative suppression by
CDK4/6 inhibition: complex function of the retinoblastoma pathway in liver tissue and hepatoma cells. Gastroenterology 138, 1920-1930 (2010)
17. M. Fraenkel, M. Gueorguiev, D. Barak, A. Salmon, A.B. Gross- man, D.J. Gross, Everolimus therapy for progressive adrenocor- tical cancer. Endocrine 44, 187-192 (2013)
18. M.C. De Martino, P.M. van Koetsveld, R.A. Feelders, S.W. Lamberts, W.W. de Herder, A. Colao, R. Pivonello, L.J. Hofland, Effects of combination treatment with sirolimus and mitotane on growth of human adrenocortical carcinoma cells. Endocrine 52, 664-667 (2016)
19. C. Fiorentini, M. Fragni, P. Perego, S. Vezzoli, S.A. Bonini, M. Tortoreto, D. Galli, M. Claps, G.A. Tiberio, M. Terzolo, C. Missale, M. Memo, G. Procopio, N. Zaffaroni, A. Berruti, S. Sigala, Antisecretive and antitumor activity of abiraterone acetate in human adrenocortical cancer: a preclinical study. J. Clin. Endocrinol. Metab. 101, 4594-4602 (2016)
20. A. Berruti, M. Terzolo, P. Sperone, A. Pia, S. Della Casa, D.J. Gross, C. Carnaghi, P. Casali, F. Porpiglia, F. Mantero, G. Reimondo, A. Angeli, L. Dogliotti, Etoposide, doxorubicin and cisplatin plus mitotane in the treatment of advanced adrenocortical carcinoma: a large prospective phase II trial. Endocr. Relat. Cancer 12, 657-666 (2005)