ORIGINAL ARTICLE
Contribution of de novo and mosaic TP53 mutations to Li-Fraumeni syndrome
Mariette Renaux-Petel,1,2 Françoise Charbonnier,1 Jean-Christophe Théry,1,3 Pierre Fermey,1 Gwendoline Lienard,1 Jacqueline Bou,1 Sophie Coutant,1 Myriam Vezain, Edwige Kasper,” Steeve Fourneaux,1 Sandrine Manase, Maud Blanluet,1 Bruno Leheup,4 Ludovic Mansuy,5 Jacqueline Champigneulle,6 Céline Chappé,7 Michel Longy,8 Nicolas Sevenet,8 Brigitte Bressac-de Paillerets,9 Léa Guerrini-Rousseau,1º Laurence Brugières,1º Olivier Caron,11 Jean-Christophe Sabourin,1,12 Isabelle Tournier,1 Stéphanie Baert-Desurmont,1 Thierry Frébourg,1 Gaëlle Bougeard1
Additional material is published online only. To view please visit the journal online (http://dx.doi.org/10.1136/ jmedgenet-2017-104976).
For numbered affiliations see end of article.
Correspondence to
Professor Thierry Frébourg, Department of Genetics, Rouen University Hospital, Inserm U1245, IRIB, Normandy Centre for Genomic and Personalized Medicine, Faculty of Medicine, 22 boulevard Gambetta, 76183 Rouen CEDEX 1, France; thierry. frebourg@chu-rouen.fr
MR-P and FC contributed equally.
Received 11 August 2017 Revised 28 September 2017 Accepted 9 October 2017
ABSTRACT
Background Development of tumours such as adrenocortical carcinomas (ACC), choroid plexus tumours (CPT) or female breast cancers before age 31 or multiple primary cancers belonging to the Li-Fraumeni (LFS) spectrum is, independently of the familial history, highly suggestive of a germline TP53 mutation. The aim of this study was to determine the contribution of de novo and mosaic mutations to LFS.
Methods and results Among 328 unrelated patients harbouring a germline TP53 mutation identified by Sanger sequencing and/or QMPSF, we could show that the mutations had occurred de novo in 40 cases, without detectable parental age effect. Sanger sequencing revealed two mosaic mutations in a child with ACC and in an unaffected father of a child with medulloblastoma. Re-analysis of blood DNA by next-generation sequencing, performed at a depth above 500X, from 108 patients suggestive of LFS without detectable TP53 mutations, allowed us to identify 6 additional cases of mosaic TP53 mutations, in 2/49 children with ACC, 2/21 children with CPT, in 1/31 women with breast cancer before age 31 and in a patient who developed an osteosarcoma at age 12, a breast carcinoma and a breast sarcoma at age 35.
Conclusions This study performed on a large series of TP53 mutation carriers allows estimating the contribution to LFS of de novo mutations to at least 14% (48/336) and suggests that approximately one- fifth of these de novo mutations occur during embryonic development. Considering the medical impact of TP53 mutation identification, medical laboratories in charge of TP53 testing should ensure the detection of mosaic mutations.
CrossMark
To cite: Renaux-Petel M, Charbonnier F, Théry J-C, et al. J Med Genet Published Online First: [please include Day Month Year]. doi: 10.1136/ jmedgenet-2017-104976
INTRODUCTION
Li-Fraumeni syndrome (LFS; Mendelian Inher- itance in Man (MIM) #151623) results from heterozygous germline mutations of the TP53 tumour suppressor gene (MIM*191170) and is characterised by a wide tumour spectrum and a diversity of age of tumour onset. Since its original recognition in 1969 by Li and Fraumeni1 and its
historical definition in 1988,2 we and others have sequentially updated the Chompret criteria for LFS to cover the different situations suggestive of LFS and to facilitate the recognition of this syndrome: (i) ‘familial’ criterion: proband with tumour belonging to LFS tumour spectrum (eg, premenopausal breast cancer, soft tissue sarcoma, osteosarcoma, CNS tumour, adrenocortical carcinoma (ACC)) before age 46, and at least one first or second-degree relative with LFS tumour (except breast cancer if proband has breast cancer) before age 56 or with multiple tumours; (ii) ‘multiple primitive tumours’ criterion: proband with multiple tumours (except multiple breast tumours), two of which belong to LFS tumour spectrum and first of which occurred before age 46; (iii) ‘rare tumours’ criterion: patient with ACC, choroid plexus tumour (CPT) or rhabdomyosarcoma of embryonal anaplastic subtype (anRMS) or (iv) ‘early-onset breast cancer’ criterion: female breast cancer before age 31.3-10
Indeed, certain individual presentations are highly suggestive of the presence of a germline TP53 mutation. Independently of the familial history, the mutation detection rate in children presenting with ACC has been estimated to be 45%-66%,5 9-12 with CPT to be 42%-100%,5 9 with anRMS up to 73%,8 and in women with breast carcinoma before age 31 to be 6%.9 13 14
The development of next-generation sequencing (NGS) technologies has recently uncovered in humans the high frequency of de novo mutations estimated to be 1.58 per exome15 and has revealed, thanks to the reading depth, the contribution of mosaic mutations in an increased number of genetic conditions.16 17 We report in this study the contri- bution of de novo mutations and mosaic TP53 mutations in sporadic clinical situations strongly suggestive of LFS.
METHODS
TP53 molecular analysis by Sanger sequencing and QMPSF
The 11 exons of TP53 were PCR amplified from blood genomic DNA and analysed using Sanger sequencing on an automated sequencer 3130xl
BMJ
Cancer genetics
Genetic Analyzer (Applied Biosystems), as previously described,4 and variant detection was performed using the Variant Reporter software V.1.1 (Applied Biosystems). The search for genomic rearrangements was performed using quantitative multiplex PCR of short fluorescent fragments (QMPSF), as previously described.18 For each patient, informed consent for genetic anal- yses was obtained.
Microsatellite analysis for fatherhood and motherhood determination
To ascertain fatherhood and motherhood, blood genomic DNA samples from child and both parents were systematically PCR-amplified using primers surrounding microsatellite loci D1S439 (AFM225xe11), D9S1784 (AFMa136xa5), D14S986 (AFMa184xa5), D19S913 (AFMb301xc9), D17S960, D17S1353 and D17S1844, whose sequences are described in the online supple- mentary table S1, and then subjected to capillary electrophoresis on an automated sequencer 3130xl Genetic Analyzer. Data were anal- ysed with the GeneMapper software V.4.1 (Applied Biosystems). Protocol details are available on request.
Libraries preparation, next-generation sequencing and bioinformatic analyses
SureSelect capture for the TP53 gene was designed using Agilent eArray (Agilent, Santa Clara, California, USA). Library prepa- ration was performed using the QXT SureSelect enrichment kit (Agilent) from 50ng of peripheral blood genomic DNA. DNA fragmentation was enzymatically performed by a transposase. After the enrichment step, independent indexed libraries were pooled. Libraries were sequenced on a MiSeq or a NextSeq 500 platform (Illumina, San Diego, California, USA) using 2×150bp paired-end sequencing. Paired-end reads were mapped on the Human hg19 genome using the Burrows-Wheeler Alignment - Maximal Exact Matches (BWA-MEM) algorithm.19 Postpro- cessing and quality score recalibration were performed using Picard and GATK software programmes (Broad Institute) according to the Broad Institute best practices. The variant caller VarScan2 V.2.3.9 (http://dkoboldt.github.io/varscan/) was used for the detection of single-nucleotide variants (SNV) and indels to be able to detect mosaic germline variants.2º Annotation of the generated vcf files was performed using Alamut Batch (Inter- active Biosoftware, Rouen, France).
Primer extension (SNAPshot)
Mosaic TP53 mutations were confirmed using the ABI PRISM SNAPshot™ Multiplex kit (Applied Biosystems). Each putative mutated exon of TP53 was PCR-amplified from blood genomic DNA, as previously described. Five microlitres of the PCR product were incubated for 1 hour at 37℃ with 1 U of Shrimp alkaline phos- phatase (SAP) and 0.8 U of exonuclease I (ExoI) in a final volume of 10 uL, to remove excess primers and unincorporated deoxynu- cleotide triphosphates (dNTPs). Enzymes were deactivated at 75°℃ for 15 min. A multiplex primer extension was performed for each mutation on both strand, from 2 uL of purified PCR, in a final volume of 10 uL using the SNAPshot™M Multiplex Ready Reaction Mix and 0.1-0.3 uM of pooled primers (see the online supple- mentary table S2). Extension consisted of 25 cycles at 96℃ for 10s, 50℃ for 5 s and 60℃ for 30s. Removal of the 5’ phosphoryl groups from unincorporated fluorescently labelled dideoxynucle- otide triphosphates ([F]ddNTPs) was performed by phosphatase treatment using 1 U SAP on 10uL of extended product, in a final volume of 15 µL, for 1 hour at 37℃. SAP was deactivated at 75℃ for 15 min. Capillary electrophoresis of SNAPshot™M products was
performed on a 3130xl Genetic Analyzer using a 120 LIZ size stan- dard. Data were analysed with the GeneMapper software V.4.1.
Cloning of TP53 mutant allele
In family F337, the genomic region surrounding TP53 exon 3 was PCR-amplified using the following primers: forward 5’ CCCCTAGCAGAGACCTGTGGG3’, and reverse 5’CCCAG- CCCAACCCTTGTCCT3’, and subjected to agarose electro- phoresis. The aberrant band was cut from the gel, purified, phosphorylated and ligated to the pcDNA3 plasmid, previ- ously EcoRV blunt digested and dephosphorylated. Bacterial clones were screened by PCR, using the T7 (5’TAATACGACT- CACTATAGGG3’) and Sp6 (5’ATTTAGGTGACACTATAG3’) universal primers. Plasmids were isolated from positive clones and Sanger sequenced using primers T7 and Sp6.
RESULTS
Using Sanger sequencing of the 11 exons completed by QMPSF, we have identified a deleterious heterozygous TP53 alteration in 328 unrelated French index cases. Among these, we found that TP53 mutations had occurred de novo in 40 cases (25 women and 15 men), including 4 cases previously reported (table 1).21 This represents 12% of this series of TP53 mutation carriers. In each case, fatherhood and motherhood were confirmed by microsatellite analyses (data not shown). For 28 index case- parent trios, we could perform NGS analysis with a 400X- 1000X read depth after TP53-enriched capture and confirm, in each case, the absence in parent blood DNA of the TP53 muta- tion detected in the index case.
Most of the patients harbouring a de novo heterozygous TP53 mutation (34/40) had been screened for TP53 because they fulfilled Chompret criteria. The phenotype of the patients is presented in table 1. The majority of the de novo TP53 muta- tions corresponded to substitutions (18 transitions, 15 transver- sions) and 7 to small deletions or duplication (table 1).
As mutation rate in gonads increases with parental age and, in particular, with paternal age,22 23 we evaluated the age of the parents for all index cases harbouring a de novo TP53 mutation. At birth of the index cases, we observed a mean and median age for fathers of 31 years (range 19-41 years) and for mothers of 28 years (range 19-47 years). These values are similar to the mean ages of childbirth observed in the general population in France, corresponding to 33 and 30 years old, in men and women, respectively (data for 2015, from Insee, the French National Institute of Statistics and Economic Studies).
We detected two cases of mosaic mutation thanks to Sanger sequencing. In family F281, we had previously identified in the index case, who presented with a sporadic medulloblastoma at 3 years of age, a germline TP53 mutation within exon 8 (NM_000546.5: c.814G>A, p.(Val272Met)). Targeted Sanger sequencing in both parents initially suggested that the mutation had occurred de novo in the germline. However, careful examination of the Sanger electro- pherograms generated from the healthy father blood DNA revealed a very weak signal corresponding to the mutant peak, which height was in the same magnitude than the sequencing background noise (figure 1). This suggested the existence of a mosaic TP53 mutation in the father. This was confirmed both by SNaPshot primer exten- sion (figure 2) and NGS analysis, showing in father blood DNA the presence of the mutation in 43 among 866 reads (5%) (table 2, see the online supplementary figure S1). The transmission of the mutation to his daughter indicated that this mosaic mutation was also present in the gonads. In another case (F315), corresponding to a boy who presented at 4 months of age with a non-secreting
| Table 1 Patients with heterozygous de novo TP53 mutations detected by Sanger sequencing | |||||
|---|---|---|---|---|---|
| Family | Sex* | Phenotype, age at diagnosist | Mutation# | Predicted effect on the protein§ | |
| F192 | M | RMS, 1 / OS, 11+19 | c.844C>T | p.(Arg282Trp) | 55% (424/767) |
| F70 | F | LMS, 39 / BC, 42 | c.476C>A | p.(Ala159Asp) | 52% (489/932) |
| F194 | M | BL, 2 / OS, 16 / GA, 17 | c.761T>A | p.(Ile254Asn) | 52% (552/1059) |
| F304 | F | ACC, 21 | c.451C>G | p.(Pro151Ala) | 51% (411/799) |
| F256 | F | ALL, 16 | c.743G>A | p.(Arg248Gln) | 49% (389/788) |
| F267 | F | OS, 16 / BC, 28 | c.743G>A | p.(Arg248Gln) | 49% (517/1048) |
| F234 | M | RMS, 2 / OS, 12 | c.518T>C | p.(Val173Ala) | 49% (524/1067) |
| F126 | M | WT, 2 / MB, 7 | c.378C>G | p.(Tyr126*) | 49% (354/724) |
| F279 | F | ACC, 5 | c.527G>A | p.(Cys176Tyr) | 49% (475/974) |
| F215 | F | ACC, 25 / BC, 28 | c.844C>T | p.(Arg282Trp) | 48% (327/678) |
| F66 | F | OS, 18 / Bilat BC, 34+35 | c.310C>T | p.(Gln104*) | 48% (360/750) |
| F270 | M | BCC, 33 / UPS, 40 | c.613T>G | p.(Tyr205Asp) | 48% (307/643) |
| F60 | F | Bilat BC, 25+35 | c.1009C>T | p.(Arg337Cys) | 47% (482/1015) |
| F50 | F | RMS, 1 / OS, 2 | c.814G>A | p.(Val272Met) | 47% (243/517) |
| F143 | F | RMS, 1 / RMS, 2 | c.672+1G>T | p .? | 47% (337/717) |
| F235 | M | CPC, 0.5 | c.365_366del | p.(Val122Aspfs*26) | 46% (311/672) |
| F174 | F | OS, 11 | c.919+1G>T | p .? | 43% (284/667) |
| F47 | F | BC, 26 / GB, 27 | c.393_395del | p.(Asn131del) | 42% (321/761) |
| F83 | M | STS, 38+44 | c.329G>C | p.(Arg110Pro) | 42% (352/839) |
| F171 | F | CPC, 1 | c.524G>A | p.(Arg175His) | 41% (354/865) |
| F38 ** | M | OS, 19 / CS, 31 | c.842A>T | p.(Asp281Val) | 41% (266/655) |
| F148 | F | CPC, 17 / BS, 24 | c.845G>C | p.(Arg282Pro) | 38% (225/585) |
| F199 | F | Bilat BC, 30 | c.782+1G>A | p .? | 38% (452/1200) |
| F287 | F | HD, 16 / AML, 24 / BC, 25 | c.428T>C | p.(Val143Ala) | 34% (302/877) |
| F266 | M | GB, 3 | c.731G>A | p.(Gly244Asp) | 34% (363/1077) |
| F127 | F | Bilat BC, 29 | c.913_916del | p.(Lys305Glufs*39) | 30% (175/575) |
| F186 | F | Bilat BC, 25 | c.632_641 del | p.(Thr211Ilefs*33) | 28% (202/733) |
| F277 | M | MB, 9 / OS, 13 | c.96+31_97-32del | p .? | 14% (76/550) |
| F7 | F | STS, 2 / ACC, 6 / OS, 14 / Bilat BC, 24+25 | c.535C>T | p.(His179Tyr) | ND |
| F62 ** | F | ACC, 1 / RMS, 1 / OS, 17 | c.818G>T | p.(Arg273Leu) | ND |
| F96 ** | M | CPC, 4 | c.733G>A | p.(Gly245Ser) | ND |
| F115 | F | Bilat BC, 27 | c.390_426del | p.(Asn131Cysfs*27) | ND |
| F118 ** | M | MB, 10 | c.376-2A>G | p .? | ND |
| F155 | F | BC, 52 | c.524G>A | p.(Arg175His) | ND |
| F180 | M | Liposarcoma, 46 / AML, 48 | c.743G>A | p.(Arg248Gln) | ND |
| F245 | F | CRC, 24 / Bilat BC, 31+34 | c.374C>A | p.(Thr125Lys) | ND |
| F321 | F | BC, 29 / OS, 35 | c.681 dup | p.(Asp228*) | ND |
| F327 | M | No tumour, 33 | c.535C>G | p.(His179Asp) | ND |
| F342 | F | Bilat BC, 26 | c.817C>G | p.(Arg273Gly) | ND |
| F343 | M | ACC, 1 | c.844C>T | p.(Arg282Trp) | ND |
*F, female; M, male.
tAge of tumour onset in years is indicated.
cDNA numbering with the first nucleotide corresponding to the A of the ATG translation initiation codon in the reference sequence (GenBank RefSeq-file accession number NM_000546.5).
§Protein numbering with the initiation codon numbered as codon 1 (accession number NP_000537.3).
“ND, not determined.
** Previously described in Chompret et al. (Br J Cancer 2000).21
ACC, adrenocortical carcinoma; ALL, acute lymphoblastic leukaemia; AML, acute myeloid leukaemia; BC, breast carcinoma; BCC, basal cell carcinoma; Bilat, bilateral; BL, Burkitt’s lymphoma; BS, breast sarcoma; CPC, choroid plexus carcinoma; CRC, colorectal carcinoma; CS, chondrosarcoma; GB, glioblastoma; GA, gastric adenocarcinoma;
HD, Hodgkin’s disease; LMS, leiomyosarcoma; MB, medulloblastoma; OS, osteosarcoma; RMS, rhabdomyosarcoma; STS, soft tissue sarcoma; UPS, undifferentiated pleomorphic sarcoma; WT, Wilm’s tumour.
voluminous ACC, Sanger sequencing also revealed a mosaic missense TP53 mutation in exon 7c.[722C=/>T], p.[Ser241=/ (Ser241Phe)] (figure 1). This mutation was confirmed by SNAPshot analysis (figure 2) and by NGS (table 2, see the online supplemen- tary figure S1) showing 17% of mutant alleles (181/1060).
Then, in order to detect more extensively mosaic TP53 muta- tions, we reanalysed by NGS performed with a reading depth above 500X, 108 other patients with clinical presentations strongly suggestive of LFS, corresponding either to ACC (n=55), CPT (n=21), breast carcinoma before age 31 (n=31) or multiple primary
A
GT
F281 index case
F
F281 index case
R
B
F337 index case (blood)
F
AGACTTCCTGAAAACAACGTTCTGGT
F281 father
F
F281 father
R
TGTCTTTCAGACTTCCT
F337 index case (cloned allele)
F
TGTCTTTCAGACTTCCTTGTCTTTCAGACTTCCT
F281 mother
F
F281 mother
R
C
F315 index case (blood)
F
MAMANA
F315 index case
F
F315 index case
R
NUMAWIEMEIN
F315 index case (ACC)
F
F308 index case
F
F308 index case
R
F308 index case (blood)
F
MALM F308 index case F (ACC) Math
F319 index case
F
F319 index case
R
F320 index case
Whenlove M
F
F320 index case
R
F331 index case (blood)
F
F332 index case F F332 index case Marlonhan
WOMANM
R
F331 index case (breast sarcoma)
F
AMmann
F331 index case
F
F331 index case
R
F331 index case (breast carcinoma)
F
hmm
tumours (n=1) but without detectable TP53 mutations using Sanger and QMPSF.
First, we analysed children with ACC. Sanger sequencing of TP53 performed on an updated ACC cohort to 146 patients (97 children, 49 adults) had revealed a TP53 mutation in a total of 45 children (46%), including the mosaic mutation described above, and 7 adults (14%) (1 man and 6 women) in agree- ment with our previous estimates obtained on a smaller series.9 We reanalysed, using NGS, blood DNA from 49 children (31
women (0.1-18 years), 18 men (0.1-17 years)) and 6 adults (4 women (20-58 years), 2 men (24-50 years)) with ACC but without detectable TP53 mutations. This revealed two addi- tional cases of mosaic mutation in early-onset ACC: (i) in a girl (F308) who at 8 months of age presented with an ACC revealed by hyperandrogenism and became metastatic at age 3, a nonsense mutation c.[548C=/>A], p.[Ser183=/(Ser183*)] in exon 5 was detected in 17% of the NGS reads (145/832) (table 2, figure 3); (ii) in a girl (F337) who presented with
F281 index case
F315 index case
G
A
1
G
F320 index case
G
C
T
C
T
C
¥
A
A
T
2
F281 father
G
F308 index case
F332 index case
G
G
C
A
C
A
T
T
C
A
T
F281 mother
G
F319 index case
G
F331 index case
C
C
C
G
T
A
A
T
a 5 cm ACC at 14 months of age, a partial TP53 duplication extending from intron 2 to exon 3, was detected in 4% of the reads (25/571) (table 2). A specific PCR amplification and Sanger sequencing (figure 1) of the cloned aberrant fragment confirmed the 17 bp duplication, annotated by Varscan2 as c. [75-10_81=/dup] and predicted to result into a mutant trun- cated protein p.[Glu28=/(Glu28Cysfs*22)].
In an extended series of patients with CPT composed of 43 patients, including only one adult case, Sanger sequencing had revealed a heterozygous mutation in 17 patients (40%), in agree- ment with our previous estimate.9 Twenty-one children with
CPT (14 boys, 7 girls, range 0.1-16 years), without detectable mutations, were then reanalysed by NGS. This allowed us to identify two other cases of mosaic TP53 mutations affecting hot spots: (i) c.[742C=/>T], p.[Arg248=/(Arg248Trp)] within exon 7 detected in 14% of the reads (263/1933) in a boy (F319) who presented with a sporadic choroid plexus carcinoma at 2 years of age, and (ii) c.[818G=/>A], p.[Arg273=/(Arg273His)], within exon 8 in 19% of the reads (359/1908) in a boy (F320) who presented with an atypical sporadic choroid plexus papilloma at 6 months of age (table 2, see the online supplementary figure S1).
| Table 2 Patients with mosaic TP53 mutations | ||||||
|---|---|---|---|---|---|---|
| Family | Sex* | Phenotype, age at diagnosist | Mutation# | Predicted effect on the protein§ | Percentage of mutant reads | Tumour analysis 1 |
| F281 | M | No tumour, 42 | c.[814G=/>A] | p.[Val272=/(Val272Met)] | 5% (43/866) | / |
| F315 | M | ACC, 0.3 | c.[722C=/>T] | p.[Ser241=/(Ser241Phe)] | 17% (181/1060) | LOH |
| F308 | F | ACC, 0.7 | c.[548C=/>A] | p.[Ser183=/(Ser183*)] | 17% (145/832) | LOH |
| F337 | F | ACC, 1 | c.[75-10_81=/dup] | p.[Glu28=/(Glu28Cysfs*22)] | 4% (25/571) | ND |
| F319 | M | CPC, 2 | c.[742C=/>T] | p.[Arg248=/(Arg248Trp)] | 14% (263/1928) | ND |
| F320 | M | Atypical CPP, 0.5 | c.[818G=/>A] | p.[Arg273=/(Arg273His)] | 19% (359/1902) | ND |
| F332 | F | Bilat BC, 27+34 | c.[1024C=/>T] | p.[Arg342=/(Arg342*)] | 17% (699/4120) | ND |
| F331 | F | OS, 12 / L. BC, 35 / R. BS, 35 | c.[375+1G=/>A] | p.[=/?] | 7% (40/551) | LOH |
*F, female; M, male.
tAge of tumour onset in years is indicated.
cDNA numbering with the first nucleotide corresponding to the A of the ATG translation initiation codon in the reference sequence (GenBank RefSeq-file accession number NM_000546.5).
§Protein numbering with the initiation codon numbered as codon 1 (accession number NP_000537.3).
ILOH, loss of heterozygosity; ND, not determined.
ACC, adrenocortical carcinoma; BC, breast carcinoma; Bilat, bilateral; BS, breast sarcoma; CPC, choroid plexus carcinoma; CPP, choroid plexus papilloma; L, left; OS, osteosarcoma; R, right.
TP53 exon 5
TP53 intron 5
| TP53: NM_000546.5 | c.548 | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| c.530 | c.540 | c.550 | c.559 | c.559+10 | |||||
| CCCCACCATGAGCGCTGCTCAGATAGCGATGGTGAGCAGCTG | |||||||||
| P | H | H | E | R | C | S D | S D G | ||
180
-
p.183
185
187
BAM alignment
genomic reference sequence: Chr17:GRCh37(hg19)
GG GG TGGTACTCGCGACGAGTCTATCGCTACCACTCGTCGAC
depth
C
G: 687 (83%, 366+, 321-)
T: 145 (17%, 73+, 72-)
T
T
T
C
T
M
Ţ
T
T
T
T
T
T
Considering that the occurrence of breast cancer in women at a very early age (<31 years) is also suggestive of a germline TP53 mutation, with a mutation detection rate estimated to be 4%-6%,9 13 14 blood genomic DNA from 31 women with very early-onset breast cancer (mean 26 years, range 20-30 years) but without TP53 mutations detectable by Sanger sequencing and QMPSF were submitted to NGS analysis. A mosaic TP53 nonsense mutation was detected in 17% of the reads (699/4120) in a woman who presented with a bilateral breast cancer at 27 and 34 years of age (F332): c.[1024C=/>T], p.[Arg342=/(Arg342*)], exon 10 (table 2, see the online supplementary figure S1).
Finally, we reanalysed by NGS a patient (F331), who had developed multiple early primary tumours strongly suggestive of a TP53 mutation. This female patient had developed an osteo- sarcoma of the skull diagnosed at 12 years of age and treated by surgery and chemotherapy, then at 35 years of age, she presented with a left breast ductal carcinoma in situ (DCIS) and a right breast sarcoma. While Sanger sequencing had initially failed to detect TP53 mutation, NGS performed on blood DNA revealed on 7% of the reads (40/551) a splicing mutation affecting the donor site of intron 4: c.[375+1G=/>A], p.[=/?] (table 2, see the online supplementary figure S1).
In these six additional mosaic TP53 mutations revealed by NGS, subsequent re-examination of the Sanger electro- pherograms revealed a trace of the mutant allele (figure 1).
Interestingly, the presence of the mosaic mutation was detect- able using SNAPshot analysis (figure 2). Among the eight cases of mosaic TP53 mutations, tumour DNA was available only in cases F315, F308 and F331 and Sanger sequencing showed, in each case, the presence of the mutation and LOH within the tumour (figure 1). In particular, in patient F331, who had developed multiple primary tumours, the mutation was detected in both tested tumours (figure 1C), confirming the mosaicism.
DISCUSSION
In this study, we report the detection of a total of 48 de novo TP53 mutations including 8 cases of mosaic mutations (tables 1 and 2). The contribution of de novo TP53 mutations to LFS had already been established by several reports, but mostly focused on single cases.24-39 From a series of 75 patients with a germline TP53 muta- tion, for whom clinical presentation was not detailed, Gonzalez et al reported that in at least 5 cases (7%), the mutation had occurred de novo.31 In our study, de novo TP53 mutations represented 14% (48/336) of the mutations identified in the index cases. As DNA was not systematically available from both parents of each index case, it is likely that this percentage underestimates the real contribution of de novo TP53 mutations to LFS. In this series of 336 LFS cases, we could establish that the mutation was inherited in 110 cases and for 43 cases, a family history very suggestive of LFS allowed us to assume that the mutation was also inherited, indicating that the contribution of inherited mutations to LFS can be estimated to be at least 46%. For 55 cases (16%), the familial history suggested a possible inheritance and, in the 80 remaining other cases (24%), the absence of suggestive familial history could be explained either by incomplete penetrance of some mutations or additional cases of de novo mutations. For the 47 childhood ACC and 19 CPT cases associated with TP53 mutations, this repartition between proven or presumed inherited mutations, possibly inherited mutations, presumed incomplete penetrance or de novo mutations and proven de novo mutations was, respectively, 62% and 53%; 6% and 0%; 19% and 16% and 13% and 32%. The contribution of de novo mutations to LFS, in complement to the incomplete penetrance of TP53 mutations, reinforces the message that the diagnosis of LFS should be considered, independently of the familial history, in patients with strongly suggestive clinical presentations such as ACC, CPT, early-onset breast cancers or multiple primary cancers belonging to the LFS spectrum.
Only few TP53 mosaic mutations have been reported so far. Thanks to the sensitivity of NGS performed at a high depth on blood, we found, among the 48 cases with TP53 de novo mutations, a total of 8 cases of mosaic mutations, indicating that in 17% (8/48) of these cases the TP53 mutation had occurred during embryonic development (table 2). It has been suggested that chemotherapy and, in particular extended chemotherapy, may induce somatic TP53 mutations in haematopoietic cells, mimicking therefore the presence of mosaic mutations.43 Among the eight cases with a TP53 mutation detected in a small fraction of the reads generated from blood DNA, we could show in the three cases (F308, F315, F331) for whom tumour DNA was available, the presence of the mutation and LOH within the tumour (figure 1), supporting the involvement of the TP53 mutation in tumour development. In an additional case (F337), the patient had not received chemotherapy, refuting this hypothesis.
An alternative hypothesis would be that the mosaic mutations detected in blood from the six affected individuals (F315, F308, F337, F319, F320, F332 and F331) corresponded to somatic mutations and reflected the presence of circulating tumour DNA. We think that we can exclude this hypothesis, at least in four of
six affected patients: (i) in patient F331 who developed multiple primary tumours, the mutation was detected in two different primary tumours, (figure 1C) confirming the true mosaicism; (ii) as highlighted by numerous studies, the presence of circulating tumour DNA is correlated with tumour burden.44 In patients F315 and F308 with ACC, NGS was performed in both cases on blood sampling 3 weeks after the complete surgical resection of the tumours; in patient F319 with CPC who was treated by chemotherapy and surgery, brain MRI performed at the time of blood sampling had revealed no brain tumour recurrence; and in patient F332 who developed bilateral breast cancer at 27 and 34 years of age, blood sampling was performed 18 years after the second tumour.
In contrast, we cannot exclude that we have underestimated the contribution of TP53 mosaic mutations to LFS. First, despite the remarkable sensitivity of NGS sequencing performed at a high depth, the detection of mosaic mutations from blood DNA requires that they are present within the haematopoietic lineage. As recently shown in adenomatous polyposis,45 only NGS performed on non-malignant tissues from tumours would allow providing an accurate estimate. Second, as shown in table 1, among the 40 cases with de novo mutations initially detected by Sanger, we analysed by NGS 28 trios and observed, for some index cases, an allelic imbalance up to 28%. Although we cannot exclude that this may be explained by a technical artefact during the capture or sequencing process, it might suggest that, at least for some of these patients, the mutation was mosaic and had occurred not at the prezygotic but postzygotic stage. Our study illustrates how NGS technologies, as previously highlighted,16 17 provide new opportunities to access mosaic mutations undetectable or hardly detectable by Sanger sequencing.
Including mosaic mutations, we detected in blood from 97 chil- dren with ACC and 42 with CPT, a TP53 mutation in 47 and 19 patients, respectively, corresponding to a mutation detection rate of 48% and 45%. This confirms that inactivation of TP53 is the main genetic cause of the development of ACC and CPT, which should be considered as emblematic tumours of LFS.5 9-12
Among a limited number of patients who developed breast cancer before 31 years of age or multiple primary cancers including early-breast cancers, we identified a mosaic mutation in a patient with bilateral breast cancer and in another who developed three cancers including a bilateral breast cancer at 35 years of age. This confirms that these both clinical presentations are also suggestive of the presence of a TP53 mutation.
Identification of a TP53 mosaic mutation has major consequences for genetic counselling in families. Indeed, the occurrence of a malignancy in a child or a young adult creates a legitimate anxiety in the parents and siblings concerned by the risk of recurrence. Demonstration that the TP53 mutation detected in the index case has occurred at the postzygotic stage allows reassuring parents and siblings. In contrast, as illustrated by family F281, mosaic mutations detected in blood may also be present in germline cells and may expose the offspring to the same risk as non-mosaic mutations. Iden- tification of a mosaic TP53 mutation has also drastic impacts for the patient. Indeed, it has now been established that in TP53 mutation carriers, radiotherapy contributes to the development of secondary tumours and should therefore be, whenever possible, avoided.9 This rule should also probably be applied to patients with mosaic TP53 mutations as it is not possible, at the present time, to determine on a routine basis which tissues carry the mutation. Patients with mosaic mutations should also benefit from surveillance protocols, such as those which have recently been elaborated for germline TP53 muta- tion carriers. These protocols are based, from the first year of age, on abdominal ultrasound every 6 months, annual total body MRI, annual brain MRI and in women from 20 years on annual breast
MRI.46 Nevertheless, the benefits of such heavy protocols regardless to the psychological impacts might be questionable in these patients with mosaic TP53 mutations, as one cannot exclude that the mosaic mutation might be restricted to certain tissues.
In conclusion, we have shown from a large series of TP53 mutation carriers that de novo mutations represent 14% (48/336) of the mutations, confirming that familial history of cancer is not mandatory to consider the presence of a TP53 mutation, that certain sporadic cancers such as ACC, CPT in children or female breast cancers occurring before age 31 or multiple primary cancers belonging to the LFS spectrum are highly suggestive of the presence of a TP53 mutation. Consid- ering the medical impacts for the patients and the families of a TP53 mutation, we think that medical laboratories in charge of TP53 testing should ensure in patients with these clinical presentations detection of mosaic mutations, by performing NGS on blood at a high depth or on non-malignant cells from tumour specimens.
Author affiliations
1Department of Genetics, Normandy Centre for Genomic and Personalized Medicine, Normandie University, UNIROUEN, Inserm U1245 and Rouen University Hospital, Rouen, France
2Department of Paediatric Surgery, Rouen University Hospital, Rouen, France
3Department of Medical Oncology, Henri Becquerel Centre, Rouen, France
4Department of Clinical Genetics, Nancy University Hospital, Nancy, France 5Department of Paediatric Oncology, Nancy University Hospital, Nancy, France 6Department of Pathology, Nancy University Hospital, Nancy, France
7Department of Paediatric Oncology, Rennes University Hospital, Rennes, France
8Department of Molecular Genetics, Bergonié Institute, Bordeaux, France
9Department of Medical Biology and Pathology, and Inserm U1186, Gustave Roussy, University of Paris-Saclay, Villejuif, France
10 Child and Adolescent Cancer Department, Gustave Roussy Cancer Campus, Villejuif, France
11Department of Oncology, Gustave Roussy Cancer Campus, Villejuif, France
12 Department of Pathology, Rouen University Hospital, Rouen, France
Acknowledgements The authors gratefully acknowledge the LFS families for their helpful contribution to this study. The authors are grateful to the French LFS network, with special thanks to C Abadie, S Audebert, E Barouk, P Benusiglio, P Berthet, Y J Bignon, B Buecher, V Bonadona, C Colas, M A Collonge-Rame, I Coupier, O Delattre, P Denizeau, H Dreyfus, M Gauthier-Villars, P Gesta, S Giraud, O Ingster, S Lejeune, D Leroux, J M Limacher, E Luporsi, E Morin-Meschin, I Mortemousque, L Olivier-Faivre, M F Petit, D Stoppa-Lyonnet, A Toutain, L Venat-Bouvet, P Vennin and Hélène Zattara. The authors acknowledge the NGS core facility located at the Faculty of Medicine of Rouen.
Contributors GB and TF: conceived the project. BBP, LB, OC, CC, JC, LG, BL, ML, LM, J-CS and NS: contributed to patient recruitment and/or provided materials. MB, JB, FC, PF, SF, EK, GL, SM, MR-P and J-CT: contributed to molecular analyses. MV and SC: performed bioinformatics analyses. SB-D, JB, GB, FC, PF, TF, GL, M-RP, NS, J-CT and IT: performed data analysis and interpretation. MB, JB, GB, FC, SC, TF, M-RP and IT: wrote the manuscript. All authors: approved the manuscript.
Funding This work was supported by the INCa, the French National Cancer Institute and the ARC Foundation for Cancer Research.
Competing interests None declared.
Patient consent Obtained.
Provenance and peer review Not commissioned; externally peer reviewed.
@ Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
REFERENCES
1 Li FP, Fraumeni JF. Soft-tissue sarcomas, breast cancer, and other neoplasms. A familial syndrome? Ann Intern Med 1969;71:747-52.
2 Li FP, Fraumeni JF, Mulvihill JJ, Blattner WA, Dreyfus MG, Tucker MA, Miller RW. A cancer family syndrome in twenty-four kindreds. Cancer Res 1988;48:5358-62.
3 Chompret A, Abel A, Stoppa-Lyonnet D, Brugiéres L, Pagés S, Feunteun J, Bonaïti-Pellié C. Sensitivity and predictive value of criteria for p53 germline mutation screening. J Med Genet 2001;38:43-7.
4 Bougeard G, Sesboué R, Baert-Desurmont S, Vasseur S, Martin C, Tinat J, Brugières L, Chompret A, de Paillerets BB, Stoppa-Lyonnet D, Bonaïti-Pellié C, Frébourg T. French
Cancer genetics
LFS working group. Molecular basis of the Li-Fraumeni syndrome: an update from the French LFS families. J Med Genet 2008;45:535-8.
5 Gonzalez KD, Noltner KA, Buzin CH, Gu D, Wen-Fong CY, Nguyen VQ, Han JH, Lowstuter K, Longmate J, Sommer SS, Weitzel JN. Beyond Li Fraumeni syndrome: clinical characteristics of families with p53 germline mutations. J Clin Oncol 2009;27:1250-6.
6 Tinat J, Bougeard G, Baert-Desurmont S, Vasseur S, Martin C, Bouvignies E, Caron O, Bressac-de Paillerets B, Berthet P, Dugast C, Bonaïti-Pellié C, Stoppa-Lyonnet D, Frébourg T. 2009 version of the Chompret criteria for Li Fraumeni syndrome. J Clin Oncol 2009;27:e108-9.
7 Ruijs MW, Verhoef S, Rookus MA, Pruntel R, van der Hout AH, Hogervorst FB, Kluijt I, Sijmons RH, Aalfs CM, Wagner A, Ausems MG, Hoogerbrugge N, van Asperen CJ, Gomez Garcia EB, Meijers-Heijboer H, Ten Kate LP, Menko FH, van’t Veer LJ. TP53 germline mutation testing in 180 families suspected of Li-Fraumeni syndrome: mutation detection rate and relative frequency of cancers in different familial phenotypes. J Med Genet 2010;47:421-8.
8 Hettmer S, Archer NM, Somers GR, Novokmet A, Wagers AJ, Diller L, Rodriguez- Galindo C, Teot LA, Malkin D. Anaplastic rhabdomyosarcoma in TP53 germline mutation carriers. Cancer 2014;120:1068-75.
9 Bougeard G, Renaux-Petel M, Flaman JM, Charbonnier C, Fermey P, Belotti M, Gauthier-Villars M, Stoppa-Lyonnet D, Consolino E, Brugières L, Caron O, Benusiglio PR, Bressac-de Paillerets B, Bonadona V, Bonaïti-Pellié C, Tinat J, Baert-Desurmont S, Frebourg T. Revisiting Li-Fraumeni syndrome from TP53 mutation carriers. J Clin Oncol 2015;33:2345-52.
10 Wasserman JD, Novokmet A, Eichler-Jonsson C, Ribeiro RC, Rodriguez-Galindo C, Zambetti GP, Malkin D. Prevalence and functional consequence of TP53 mutations in pediatric adrenocortical carcinoma: a children’s oncology group study. J Clin Oncol 2015;33:602-9.
11 Wagner J, Portwine C, Rabin K, Leclerc JM, Narod SA, Malkin D. High frequency of germline p53 mutations in childhood adrenocortical cancer. J Natl Cancer Inst 1994;86:1707-10.
12 Varley JM, McGown G, Thorncroft M, James LA, Margison GP, Forster G, Evans DG, Harris M, Kelsey AM, Birch JM. Are there low-penetrance TP53 Alleles? evidence from childhood adrenocortical tumors. Am J Hum Genet 1999;65:995-1006.
13 Mouchawar J, Korch C, Byers T, Pitts TM, Li E, McCredie MR, Giles GG, Hopper JL, Southey MC. Population-based estimate of the contribution of TP53 mutations to subgroups of early-onset breast cancer: Australian Breast Cancer Family Study. Cancer Res 2010;70:4795-800.
14 Evans DG, Moran A, Hartley R, Dawson J, Bulman B, Knox F, Howell A, Lalloo F. Long- term outcomes of breast cancer in women aged 30 years or younger, based on family history, pathology and BRCA1/BRCA2/TP53 status. Br J Cancer 2010; 102:1091-8.
15 Gilissen C, Hehir-Kwa JY, Thung DT, van de Vorst M, van Bon BW, Willemsen MH, Kwint M, Janssen IM, Hoischen A, Schenck A, Leach R, Klein R, Tearle R, Bo T, Pfundt R, Yntema HG, de Vries BB, Kleefstra T, Brunner HG, Vissers LE, Veltman JA. Genome sequencing identifies major causes of severe intellectual disability. Nature 2014;511:344-7.
16 Gajecka M. Unrevealed mosaicism in the next-generation sequencing era. Mol Genet Genomics 2016;291:513-30.
17 Qin L, Wang J, Tian X, Yu H, Truong C, Mitchell JJ, Wierenga KJ, Craigen WJ, Zhang VW, Wong LC. Detection and quantification of mosaic mutations in disease genes by next-generation sequencing. J Mol Diagn 2016; 18:446-53.
18 Bougeard G, Brugières L, Chompret A, Gesta P, Charbonnier F, Valent A, Martin C, Raux G, Feunteun J, Bressac-de Paillerets B, Frébourg T. Screening for TP53 rearrangements in families with the Li-Fraumeni syndrome reveals a complete deletion of the TP53 gene. Oncogene 2003;22:840-6.
19 Li H. Aligning sequence reads, clone sequences and assembly contigs with BWA- MEM. 2013. [q-bio.GN] https://arxiv.org/abs/1303.3997
20 Koboldt DC, Zhang Q, Larson DE, Shen D, Mclellan MD, Lin L, Miller CA, Mardis ER, Ding L, Wilson RK. VarScan 2: somatic mutation and copy number alteration discovery in cancer by exome sequencing. Genome Res 2012;22:568-76.
21 Chompret A, Brugières L, Ronsin M, Gardes M, Dessarps-Freichey F, Abel A, Hua D, Ligot L, Dondon MG, Bressac-de Paillerets B, Frébourg T, Lemerle J, Bonaïti-Pellié C, Feunteun J. P53 germline mutations in childhood cancers and cancer risk for carrier individuals. Br J Cancer 2000;82:1932-7.
22 Rahbari R, Wuster A, Lindsay SJ, Hardwick RJ, Alexandrov LB, Turki SA, Dominiczak A, Morris A, Porteous D, Smith B, Stratton MR, Hurles ME. UK10K Consortium. Timing, rates and spectra of human germline mutation. Nat Genet 2016;48:126-33.
23 Goldmann JM, Wong WS, Pinelli M, Farrah T, Bodian D, Stittrich AB, Glusman G, Vissers LE, Hoischen A, Roach JC, Vockley JG, Veltman JA, Solomon BD, Gilissen C, Niederhuber JE. Parent-of-origin-specific signatures of de novo mutations. Nat Genet 2016;48:935-9.
24 Gutiérrez MI, Bhatia KG, Barreiro C, Spangler G, Schvartzmann E, Muriel FS, Magrath IT. A de novo p53 germline mutation affecting codon 151 in a six year old child with multiple tumors. Hum Mol Genet 1994;3:2247-8.
25 Ayan I, Luca J, Jaffe N, Strong L, Hansen M. De novo germline mutations of the p53 gene in young children with sarcomas. Oncol Rep 1997;4:679-83.
26 Patrikidou A, Bennett J, Abou-Sleiman P, Delhanty JD, Harris M. A novel, de novo germline TP53 mutation in a rare presentation of the Li-Fraumeni syndrome in the maxilla. Oral Oncol 2002;38:383-90.
27 Bendig I, Mohr N, Kramer F, Weber BH. Identification of novel TP53 mutations in familial and sporadic cancer cases of German and Swiss origin. Cancer Genet Cytogenet 2004;154:22-6.
28 Nogales FF, Musto ML, Sáez AI, Robledo M, Palacios J, Aneiros J. Multifocal intrafollicular granulosa cell tumor of the ovary associated with an unusual germline p53 mutation. Mod Pathol 2004;17:868-73.
29 Salmon A, Amikam D, Sodha N, Davidson S, Basel-Vanagaite L, Eeles RA, Abeliovich D, Peretz T. Rapid development of Post-radiotherapy sarcoma and breast cancer in a patient with a novel germline ‘de-novo’ TP53 mutation. Clin Oncol 2007;19:490-3.
30 Russell-Swetek A, West AN, Mintern JE, Jenkins J, Rodriguez-Galindo C, Ribeiro R, Zambetti GP. Identification of a novel TP53 germline mutation E285V in a rare case of paediatric adrenocortical carcinoma and choroid plexus carcinoma. J Med Genet 2008;45:603-6.
31 Gonzalez KD, Buzin CH, Noltner KA, Gu D, Li W, Malkin D, Sommer SS. High frequency of de novo mutations in Li-Fraumeni syndrome. J Med Genet 2009;46:689-93.
32 Pinto C, Veiga I, Pinheiro M, Peixoto A, Pinto A, Lopes JM, Reis RM, Oliveira C, Baptista M, Roque L, Regateiro F, Cirnes L, Hofstra RM, Seruca R, Castedo S, Teixeira MR. TP53 germline mutations in Portugal and genetic modifiers of age at cancer onset. Fam Cancer 2009;8:383-90.
33 Schniederjan MJ, Shehata B, Brat DJ, Esiashvili N, Janss AJ. De novo germline TP53 mutation presenting with synchronous malignancies of the central nervous system. Pediatr Blood Cancer 2009;53:1352-4.
34 Schwarzbraun T, Obenauf AC, Langmann A, Gruber-Sedlmayr U, Wagner K, Speicher MR, Kroisel PM. Predictive diagnosis of the cancer prone Li-Fraumeni syndrome by accident: new challenges through whole genome array testing. J Med Genet 2009;46:341-4.
35 Choong SS, Latiff ZA, Mohamed M, Lim LL, Chen KS, Vengidasan L, Razali H, Abdul Rahman EJ, Ariffin H. Malaysian Society of Paediatric Haematology-Oncology. Childhood adrenocortical carcinoma as a sentinel cancer for detecting families with germline TP53 mutations. Clin Genet 2012;82:564-8.
36 Jhaveri AP, Bale A, Lovick N, Zuckerman K, Deshpande H, Rath K, Schwartz P, Hofstatter EW. The benefit and burden of cancer screening in Li-Fraumeni syndrome: a case report. Yale J Biol Med 2015;88:181-5.
37 Schlegelberger B, Kreipe H, Lehmann U, Steinemann D, Ripperger T, Göhring G, Thomay K, Rump A, Di Donato N, Suttorp M. A child with Li-Fraumeni syndrome: Modes to inactivate the second allele of TP53 in three different malignancies. Pediatr Blood Cancer 2015;62:1481-4.
38 Austin F, Oyarbide U, Massey G, Grimes M, Corey SJ. Synonymous mutation in TP53 results in a cryptic splice site affecting its DNA-binding site in an adolescent with two primary sarcomas. Pediatr Blood Cancer 2017;64:e26584.
39 O’Shea R, Clarke R, Berkley E, Giffney C, Farrell M, O’Donovan E, Gallagher DJ. Next generation sequencing is informing phenotype: a TP53 example. Fam Cancer. In Press. 2017.
40 Behjati S, Maschietto M, Williams RD, Side L, Hubank M, West R, Pearson K, Sebire N, Tarpey P, Futreal A, Brooks T, Stratton MR, Anderson J. A pathogenic mosaic TP53 mutation in two germ layers detected by next generation sequencing. PLoS One 2014;9:e96531.
41 Prochazkova K, Pavlikova K, Minarik M, Sumerauer D, Kodet R, Sedlacek Z. Somatic TP53 mutation mosaicism in a patient with Li-Fraumeni syndrome. Am J Med Genet A 2009;149A:206-11.
42 Zhang J, Walsh MF, Wu G, Edmonson MN, Gruber TA, Easton J, Hedges D, Ma X, Zhou X, Yergeau DA, Wilkinson MR, Vadodaria B, Chen X, McGee RB, Hines-Dowell S, Nuccio R, Quinn E, Shurtleff SA, Rusch M, Patel A, Becksfort JB, Wang S, Weaver MS, Ding L, Mardis ER, Wilson RK, Gajar A, Ellison DW, Pappo AS, Pui CH, Nichols KE, Downing JR. Germline mutations in predisposition genes in pediatric cancer. N Engl J Med 2015;373:2336-46.
43 Swisher EM, Harrell MI, Norquist BM, Walsh T, Brady M, Lee M, Hershberg R, Kalli KR, Lankes H, Konnick EQ, Pritchard CC, Monk BJ, Chan JK, Burger R, Kaufmann SH, Birrer MJ. Somatic mosaic mutations in PPM1D and TP53 in the blood of women with ovarian carcinoma. JAMA Oncol 2016;2:370-2.
44 Siravegna G, Marsoni S, Siena S, Bardelli A. Integrating liquid biopsies into the management of cancer. Nat Rev Clin Oncol 2017;14:531-48.
45 Spier I, Drichel D, Kerick M, Kirfel J, Horpaopan S, Laner A, Holzapfel S, Peters S, Adam R, Zhao B, Becker T, Lifton RP, Perner S, Hoffmann P, Kristiansen G, Timmermann B, Nöthen MM, Holinski-Feder E, Schweiger MR, Aretz S. Low-level APC mutational mosaicism is the underlying cause in a substantial fraction of unexplained colorectal adenomatous polyposis cases. J Med Genet 2016;53:172-9.
46 Kratz CP, Achatz MI, Brugières L, Frebourg T, Garber JE, Greer MC, Hansford JR, Janeway KA, Kohlmann WK, McGee R, Mullighan CG, Onel K, Pajtler KW, Pfister SM, Savage SA, Schiffman JD, Schneider KA, Strong LC, Evans DGR, Wasserman JD, Villani A, Malkin D. Cancer screening recommendations for individuals with li-fraumeni syndrome. Clin Cancer Res 2017;23:e38-45.
Downloaded from http://jmg.bmj.com/ on November 2, 2017 - Published by group.bmj.com
| JMG | Contribution of de novo and mosaic TP53 mutations to Li-Fraumeni syndrome |
| Mariette Renaux-Petel, Françoise Charbonnier, Jean-Christophe Théry, Pierre Fermey, Gwendoline Lienard, Jacqueline Bou, Sophie Coutant, Myriam Vezain, Edwige Kasper, Steeve Fourneaux, Sandrine Manase, Maud Blanluet, Bruno Leheup, Ludovic Mansuy, Jacqueline Champigneulle, Céline Chappe, Michel Longy, Nicolas Sevenet, Brigitte Bressac-de Paillerets, Léa Guerrini-Rousseau, Laurence Brugières, Olivier Caron, Jean-Christophe Sabourin, Isabelle Tournier, Stéphanie Baert-Desurmont, Thierry Frébourg and Gaëlle Bougeard J Med Genet published online October 25, 2017 | |
| Updated information and services can be found at: http://jmg.bmj.com/content/early/2017/10/25/jmedgenet-2017-104976 | |
| These include: | |
| References | This article cites 44 articles, 15 of which you can access for free at: http:/jmg.bmj.com/content/early/2017/10/25/jmedgenet-2017-104976 #BIBL |
| Email alerting service | Receive free email alerts when new articles cite this article. Sign up in the box at the top right corner of the online article. |
Notes
To request permissions go to: http://group.bmj.com/group/rights-licensing/permissions To order reprints go to: http://journals.bmj.com/cgi/reprintform
To subscribe to BMJ go to: http://group.bmj.com/subscribe/