ENDOCRINE SOCIETY

KCNJ5 somatic mutation is a predictor of hypertension remission after adrenalectomy for unilateral primary aldosteronism

Leticia A. P. Vilela, Marcela Rassi-Cruz, Augusto G. Guimaraes, Caio C. S. Moises, Thais C. Freitas, Natalia P. Alencar, Janaina Petenuci, Tatiana S. Goldbaum, Ana Alice W. Maciel, Maria Adelaide A. Pereira, Giovanio V. Silva, Andrea P. Abreu, Maria Claudia N. Zerbini, Aline C. B. S. Cavalcante, Francisco C. Carnevale, Bruna Pilan, Fernando Yamauchi, Vitor Srougi, Fabio Y. Tanno, Jose L. Chambo, Ana Claudia Latronico, Berenice B. Mendonca, Maria Candida B. V. Fragoso, Luiz A. Bortolotto, Luciano Drager, Madson Q. Almeida

The Journal of Clinical Endocrinology & Metabolism Endocrine Society

Submitted: March 05, 2019 Accepted: June 13, 2019 First Online: June 19, 2019

Advance Articles are PDF versions of manuscripts that have been peer reviewed and accepted but not yet copyedited. The manuscripts are published online as soon as possible after acceptance and before the copyedited, typeset articles are published. They are posted “as is” (i.e., as submitted by the authors at the modification stage), and do not reflect editorial changes. No corrections/changes to the PDF manuscripts are accepted. Accordingly, there likely will be differences between the Advance Article manuscripts and the final, typeset articles. The manuscripts remain listed on the Advance Article page until the final, typeset articles are posted. At that point, the manuscripts are removed from the Advance Article page.

DISCLAIMER: These manuscripts are provided “as is” without warranty of any kind, either express or particular purpose, or non-infringement. Changes will be made to these manuscripts before publication. Review and/or use or reliance on these materials is at the discretion and risk of the reader/user. In no event shall the Endocrine Society be liable for damages of any kind arising references to, products or publications do not imply endorsement of that product or publication.

THE JOURNAL OF CLINICAL ENDOCRINOLOGY & METABOLISM

ADVANCE ARTICLE: JCEM

ENDOCRINE SOCIETY

KCNJ5 mutation and outcome in primary aldosteronism

KCNJ5 somatic mutation is a predictor of hypertension remission after adrenalectomy for unilateral primary aldosteronism

Leticia A. P. Vilela1, Marcela Rassi-Cruz1, Augusto G. Guimaraes1, Caio C. S. Moises1, Thais C. Freitas”, Natalia P. Alencar”, Janaina Petenuci1, Tatiana S. Goldbaum”, Ana Alice W. Maciel1, Maria Adelaide A. Pereira1, Giovanio V. Silva4, Andrea P. Abreu4, Maria Claudia N. Zerbini3, Aline C. B. S. Cavalcante6, Francisco C. Carnevale®, Bruna Pilan6, Fernando Yamauchiº, Vitor Srougi”, Fabio Y. Tanno7, Jose L. Chambo7, Ana Claudia Latronico”, Berenice B. Mendonca”, Maria Candida B. V. Fragoso12, Luiz A. Bortolotto3, Luciano Drager3,4, Madson Q. Almeida1,2

1Unidade de Suprarrenal, Laboratório de Hormônios e Genética Molecular LIM/42, Serviço de Endocrinologia e Metabologia, Hospital das Clínicas, Faculdade de Medicina da Universidade de São Paulo, São Paulo, Brasil;

2Servico de Endocrinologia, Instituto do Câncer do Estado de São Paulo (ICESP), Faculdade de Medicina da Universidade de São Paulo, São Paulo, Brasil;

3Unidade de Hipertensão, Instituto do Coração (InCor), Faculdade de Medicina da Universidade de São Paulo, São Paulo, Brasil;

4Unidade de Hipertensão, Disciplina de Nefrologia, Hospital das Clínicas, Faculdade de Medicina da Universidade de São Paulo, São Paulo, Brasil;

5 Divisão de Anatomia Patológica, Faculdade de Medicina da Universidade de São Paulo, São Paulo, Brasil;

6Instituto de Radiologia InRad, Hospital das Clínicas, Faculdade de Medicina da Universidade de São Paulo, São Paulo, Brasil;

Serviço Urologia, Hospital das Clínicas, Faculdade de Medicina da Universidade de São Paulo, São Paulo, Brasil.

ORCID numbers:

0000-0002-2957-6148

Almeida

Madson Q

Received 05 March 2019. Accepted 13 June 2019.

Context: Primary aldosteronism (PA) is the most common cause of endocrine hypertension (HT). HT remission (defined as blood pressure <140x90 mmHg without anti-hypertensive drugs) has been reported in approximately 50% of patients with unilateral PA after adrenalectomy. HT duration and severity are predictors of blood pressure response, but the prognostic role of somatic KCNJ5 mutations is unclear.

Objective: To determine clinical and molecular features associated with HT remission after adrenalectomy in unilateral PA patients.

Methods: We retrospectively evaluated 100 PA patients (60 women; median age at diagnosis 48 yr) with a median follow-up of 26 m. Anatomopathological analysis revealed 90 APAS, one carcinoma and 9 unilateral adrenal hyperplasias. All patients had biochemical cure after unilateral adrenalectomy. KCNJ5 gene was sequenced in 76 cases.

Results: KCNJ5 mutations were identified in 33 out of 76 (43.4%) tumors: p.Gly151Arg (n= 17), p.Leu168Arg (n= 15) and p.Glu145Gln (n= 1). HT remission was reported in 37 out of 100 (37%) patients. Among patients with HT remission, 73% were women (p= 0.04), 48.6%

ADVANCE ARTICLE: JCEM

ENDOCRINE SOCIETY

used <3 antihypertensive medications (p=0.0001) and 64.9% had HT duration <10 yrs (p= 0.0015) when compared to those without HT remission. Somatic KCNJ5 mutations were associated with female gender (p= 0.004), larger nodules (p= 0.001) and HT remission (p= 0.0001). In multivariate analysis, only a somatic KCNJ5 mutation was an independent predictor of HT remission after adrenalectomy (p= 0.004).

Conclusion: The presence of a KCNJ5 somatic mutation is an independent predictor of HT remission after unilateral adrenalectomy in patients with unilateral PA.

The impact of KCNJ5 somatic mutations on hypertension remission after adrenalectomy brings new insight into the post-operative follow-up of PA patients.

Introduction

Primary aldosteronism (PA) is the most common cause of endocrine hypertension (HT) with an estimated prevalence of 10% in referred populations and 15-20% in patients with resistant HT (1). Because of the adverse cardiovascular effects of excess aldosterone that are independent of high blood pressure (BP) levels, patients with PA have higher cardiovascular morbidity and mortality than age- and sex-matched patients with essential HT and the same degree of BP elevation (2-4). The frequency of PA subtypes and hypokalemia in different cohorts depends on whether PA is routinely screened among hypertensive patients and if adrenal vein sampling (AVS) is available in the specialized center (5). In general, aldosterone-producing adenomas (APAs) account for approximately 40% and idiopathic hyperaldosteronism (bilateral hyperplasia) for around 60% of PA cases. Hypokalemia is more frequent in APAs (50%) than in idiopathic hyperaldosteronism (20%) (5). The most common cause of unilateral PA is APAs. Unilateral primary hyperplasia is considered a rare cause of PA, but probably underestimated.

Surgical treatment of unilateral PA should resolve aldosterone excess in all patients. Normalization of serum potassium levels occurs in all patients (1). Although almost all PA patients improve HT control after surgery, complete clinical success or HT remission (defined as BP <140x90 mmHg without anti-hypertensive drugs) has been reported in about 50% (range, 35-80%) of patients with unilateral PA after adrenalectomy (1,6-8). In 2001, Sawaka et al. (9) evaluated factors associated with resolution of HT after adrenalectomy in 93 PA patients. Complete clinical success (33% of the cases) was associated with having one or no first-degree relative with HT and preoperative use of two or fewer anti-hypertensive drugs in multivariate analysis (9). Shorter HT duration, higher preoperative ratio of aldosterone to plasma renin activity (A/PRA) and higher urine aldosterone levels were associated with resolution of HT only in univariate analysis or when the cutoff for BP resolution was 160/95 mmHg (8-11).

Over the past few years, somatic mutations in KCNJ5, CACNAID, ATP1A1 and ATP2B3 genes, which are involved in maintaining intracellular ionic homeostasis and cell membrane potential, have been described in APAs (12-15). Recurrent KCNJ5 mutations have been found in around 40% and 79% of APAs in European and Japanese populations, respectively (16,17). In addition, somatic activating mutations in exon 3 of CTNNBI gene were initially identified in 3 APAs diagnosed in women with PA, two presented in pregnancy and one after menopause (18). Despite of these advances in the molecular pathogenesis of APAs, only few reports evaluated the prognostic role of genetic findings in the clinical outcome after adrenalectomy (19-21). In 2013, Arnesen et al. (19) showed that KCNJ5 somatic mutations are associated with a better surgical outcome in 28 APAs. In an Australian cohort, HT cure and age <50 yrs at PA diagnosis were associated with a higher chance of harboring a KCNJ5 somatic mutation (20). However, the biochemical criteria to assess PA cure after surgery was not stated in these previous reports (19-21).

ADVANCE ARTICLE: JCEM

ENDOCRINE

SOCIETY

Heterogeneity in HT remission (raging from 35 to 80%) might reflect the absence of standardized criteria to classify outcomes of adrenalectomy for unilateral PA (1,22). Recently, the Primary Aldosteronism Surgical Outcome (PASO) study established criteria for clinical and biochemical success in unilateral PA patients after adrenalectomy (22). In our study, we employed PASO criteria to evaluated clinical and molecular features associated with HT remission in a large cohort of unilateral PA patients with complete biochemical success after unilateral adrenalectomy.

Patients and Methods

The study was approved by the Ethics Committees of the Hospital das Clínicas, University of São Paulo and informed written consent was obtained from all patients. One hundred and twenty-nine consecutive PA patients from our Institution who underwent unilateral adrenalectomy for unilateral PA were retrospectively evaluated from 1993 to 2018 (Figure 1). Clinical, biochemical and imaging data were collected from patient records. The algorithm for PA investigation was detailed described by Vilela & Almeida (23) and follows the 2016 Endocrine Society Guideline for PA management (1). A positive screening for PA was defined as an Aldosterone/Plasma renin activity (A/PRA) ≥30 or A/Renin (A/R) ≥2 with aldosterone levels ≥ 10 ng/dL. Seventy-one patients (55%) underwent at least one confirmatory test (saline infusion test, captopril challenge test or furosemide upright test). Confirmatory testing was not performed in PA patients with spontaneous hypokalemia, suppressed renin levels plus PAC >20 ng/dL (1). All PA patients not eligible for confirmatory testing according the 2016 Endocrine Society Guideline presented an A/PRA ratio >100 and also filled the criteria proposed by Namba et al. (24) to not undergo confirmatory testing. Adrenal venous sampling was successfully performed in 33 patients. Abdome computed tomography was performed in all patients. CT accuracy in predicting surgical cure of PA is approximately 60% (25). Since 92.4% of PA patients that underwent unilateral adrenalectomy in our cohort had unilateral lesions with median size of 1.8 cm and only 7.6% of the cases had bilateral lesions with AVS lateralization, our data did not reflect the truly overall accuracy of CT on PA diagnosis.

Inclusion criteria were: 1) at least 6 m of follow-up; 2) complete biochemical success after adrenalectomy define according PASO criteria: correction of hypokalemia and normalization of the aldosterone-to-renin ratio; in patients with a raised aldosterone-to-renin ratio post-surgery, aldosterone secretion should be suppressed in a confirmatory test (22). If baseline plasma aldosterone was below 10 ng/dL, then the confirmatory tests were unnecessary, even if the aldosterone-to-renin ratio was increased. After evaluation of inclusion criteria, 100 patients were enrolled in this study. Anatomopathological analysis was reviewed by a single experienced pathologist (MCNZ) and revealed 90 APAs, one carcinoma and 9 unilateral adrenal hyperplasias.

Complete clinical success or HT remission was defined as a BP <140x90 mmHg without anti-hypertensive drugs after 6 months of follow-up. The cut-off of BP ≥140x90 mmHg was used to define stage 1 HT in both European and Brazilian guideline for the management of arterial HT (26,27). Aldosterone and direct renin concentrations were measured using the LIAISON® kit (DiaSorin, Salugia, Italy). A radioimmunoassay was used to determine plasma renin activity until 2011.

Molecular analysis

After surgical resection, representative areas of tumor or hyperplastic tissue were macrodissected by a pathologist. Tumor fragments were immediately frozen in liquid nitrogen and stored at -80℃ until total RNA and DNA extraction using the AllPrep DNA/RNA Mini Kit (Qiagen, Courtaboeuf Cedex, France). Before tumor RNA and DNA

extraction, tumor fragment was cut in a cryostat and slides stained by hematoxylin and eosin to confirm the representativeness of tumor or hyperplastic tissue. cDNA was generated from 1 µg of total RNA using the commercial kit Superscript III First Strand S (Invitrogen, Carlsbad, United States). Genomic DNA was extracted using standard procedures. PCR products were sequenced in an automated ABI Prism 3700 sequencer (Applied Biosystems, Carlsbad, United States).

Tumor and hyperplastic tissues (n= 64) were screening for somatic mutations in the hot spot regions of KCNJ5, ATP1A1, ATP2B3 and CTNNB1. Exon 3 of CTNNBI gene was sequenced in tumor DNA, as previously described (28). KCNJ5, ATP1A1 and ATP2B3 cDNA were amplified using intron-spanning primers, as reported previously (16). Germline KCNJ5, ATP1A1, ATP2B3 and CTNNBI mutations were investigated in all patients with somatic mutations, as previously described (28,29).

Statistical analysis

Statistical analysis was performed using IBM SPSS Software (25.0; SPSS Inc., Chicago, IL). Continuous data are expressed as median (range). Differences in expression levels between two groups were analyzed by means of the two-tailed Mann-Whitney U test. The x test was used to compare dichotomous variables. Multivariate logistic analysis was performed with initial covariates chosen from those with p < 0.2 in the univariate analysis. Predictive factors of HT resolution were evaluated according to a stepwise multivariate logistic regression analysis, which was used to estimate hazard ratios (HR) and their 95% confidence intervals in multivariate analysis. Final model specification was tested with link test and goodness-of-fit was assessed with Hosmer and Lemeshow’s test. p <0.05 was considered significant.

Results

Unilateral PA was diagnosed in 60 women and 40 men with a median follow-up of 26 m (range, 6 to 252). Median age at diagnosis 48 yr (20 to 74). Hypokalemia was identified in 80% of the patients at the diagnosis. Thirty-seven out of 100 cases (37%) had HT remission after adrenalectomy. Patients who presented HT remission after surgery more often were women (73% vs. 47.6%; X2=4.1, p= 0.042), used less than 3 antihypertensive medications (48.6 vs. 15.9%; X2= 12.42, p= 0.0001) and had <10 yrs of HT duration before PA diagnosis (64.9 vs. 39.7%; X2= 5.91, p= 0.015) when compared to those with residual HT (Table 1). Familial history of HT was not different between patients with HT resolution or remission.

Nodule size was not different in patients with and without HT resolution [2.0 cm (0.7 to 5) vs. 1.6 cm (0.4 to 9.1), respectively; p= 0.3]. Regarding biochemical data, frequency of hypokalemia, aldosterone levels and aldosterone to renin ratio were not statistically significant between patients with and without complete clinical success. Follow-up duration was similar in both groups [24 m (6 to 201) vs. 36 m (6 to 252), respectively) (Table 1).

KCNJ5 somatic mutations were identified in 33 out of 76 (43.4%) cases: p.Gly151Arg (n= 17), p.Leu168Arg (n= 15) and p.Glu145GIn (n= 1) (Figure 2). All KCNJ5 somatic mutations were identified in APAs. The p.Leu104Arg ATP1Al somatic mutation was detected in two APAs (2.6%) and the p.Leu425_Val426del ATP2B3 somatic mutation in one APA (1.3%). Additionally, the p.Ser45Pro CTNNBI somatic mutation was identified in two APAs (2.6%). None of these patients harbored germline mutations in the genes with somatic events.

APAs harboring somatic KCNJ5 mutations were diagnosed more often in females (72.7% vs. 39.5%; X2= 8.28, p= 0.004) when compared to KCNJ5 wild type (WT) APAs (Table 2). The tumor size was larger in KCNJ5 mutant APAs [2.0 cm (0.7 to 4.0) vs. 1.3 cm (0.7 to 9.1); p= 0.001). Interestingly, the postoperative HT cure was observed in 57.6% of patients with APAs harboring a somatic KCNJ5 mutation (X2= 14.14, p= 0.0001), whereas

ENDOCRINE SOCIETY

only 16.2% of patients with KCNJ5 WT APAs had complete clinical success. Among the 33 PA patients that performed AVS before surgery, a somatic KCNJ5 mutation was also significantly associated with HT remission (67% vs. 23%; X2= 4.55, p= 0.03). The percentage of patients with HT duration <10 yrs before PA diagnosis, BMI <25 Kg/m2 or using less than 3 antihypertensive medications was not statistically different between both groups. Preoperative aldosterone levels, aldosterone to renin ratio and frequency of hypokalemia were not affected by the presence of KCNJ5 somatic mutation (Table 2).

Cortisol secretion was investigated in 15 PA patients. Ten out 15 cases had a normal cortisol after an overnight 1 mg dexamethasone suppression test (LDDST). In 5 PA patients, cortisol after LDDST ranged from 1.9 to 8.3 ug/dL (only one case >5 µg/dL). ACTH, urinary and midnight salivary cortisol were normal in all cases except in the patient with aldosterone- producing carcinoma, who presented cortisol after LDDST of 8.3 ug/dL and elevated midnight salivary cortisol. This patient needed hydrocortisone replacement for 6 months after adrenalectomy. Among these 15 cases, cortisol after LDDST did not correlate with HT remission and KCNJ5 mutational status.

According to a stepwise multivariate logistic regression analysis, only the presence of a somatic KCNJ5 mutation was an independent predictor of HT remission after adrenalectomy (relative risk 6.48, 95% confidence interval 1.83 - 22.93; p= 0.004) (Table 3). Female gender, age at PA diagnosis, HT duration, BMI <25 Kg/m2, nodule size and number of antihypertensive medications failed to reach statistical significance in the multiple regression model.

Discussion

In this study, we investigated predictive factors of HT remission after adrenalectomy for unilateral PA. Combining clinical and genetic variables in 100 consecutive PA patients, KCNJ5 somatic mutation was associated with almost 6-fold chance of complete clinical success after adrenalectomy for unilateral PA. This finding underscores the clinical utility in investigating KCNJ5 somatic mutations in unilateral PA, tailoring personalized approach regarding BP response and the need of adjunctive therapy after adrenalectomy according KCNJ5 mutational status.

KCNJ5 gene is the most frequently mutated gene in APAs. The frequency of KCNJ5 somatic mutations in our Brazilian cohort (42%) was similar to what was described in European cohorts (40%) (16,30). KCNJ5 mutational status was first correlated with PA outcome in a small cohort of 28 cases and only in univariate analysis (19). Until recently, the potential predictive role of KCNJ5 somatic mutations in predicting HT remission remained to be determined. For instance, KCNJ5 somatic mutations were associated with HT cure in an Australian cohort of PA (20). In contrast, Rossi et al. (31) did not demonstrate association between KCNJ5 mutational status and HT cure, but the frequency of KCNJ5 somatic mutation was lower than in previous reports from Europe (24%). A meta-analysis of KCNJ5 somatic mutations in APAs did not find any difference in pre-operative BP and hypokalemia, but the effect of KCNJ5 mutational status in BP control after adrenalectomy was not evaluated (30). Differently from KCNJ5 mutations, CTNNBI somatic mutations were correlated with residual HT after adrenalectomy (21). However, due to the rarity of CTNNB1 mutations in PA, only 8 patients had APAs with CTNNB1 mutations (21).

Besides the differences in the prevalence of somatic KCNJ5 mutations in APAs between Europeans (40%) and Asians (79%) (16,17,30), genetic characteristics of APAs were also distinct in African Americans (32). Nanba et al. showed that somatic CACNA1D mutations were the most prevalent genetic alteration (42%) in APAs from African Americans. In the current study, the impact of KCNJ5 somatic mutations in HT remission

ADVANCE ARTICLE: JCEM

ENDOCRINE

SOCIETY

was evaluated in a Brazilian cohort of PA patients, which has clearly distinct genetic background from other PA cohorts previously reported.

Recently, the PASO study, an international panel of 31 experts from 28 centers, developed consensus criteria for outcomes and follow-up of adrenalectomy for unilateral PA (22). The definition of criteria to assess success of adrenalectomy is essential to allow the comparison of outcome data between studies. In our study, we evaluated a robust cohort of patients with unilateral PA who presented complete biochemical success after adrenalectomy based on criteria proposed by PASO study. In contrast, a precise definition of biochemical success to determine PA cure was not stated in previous reports which evaluated the impact of genetic findings in clinical outcome after surgery for unilateral PA (19-21).

In the present study, KCNJ5 somatic mutations were more frequent in women and larger tumors, similarly to previous published data (16,20,30). Recently, Kitamoto et al. (33) showed that KCNJ5 somatic mutation, shorter duration of hypertension and fewer antihypertensive medications predicted HT remission after adrenalectomy, with the KCNJ5 somatic mutation being the most relevant predictor. Similarly, our findings demonstrated that

HT duration <10 yrs, less than 3 antihypertensive medications and KCNJ5 somatic mutation correlated with HT remission after adrenalectomy, but only KCNJ5 somatic mutation was an independent predictor in our study. Of greatest importance, KCNJ5 somatic mutation was the only independent predictor of complete clinical success after surgical treatment for unilateral PA. Based on these data, we can speculate that the benefit of surgical intervention in patients with KCNJ5 somatic mutations goes beyond an earlier PA diagnosis.

In a cohort of 474 APAs from the European Network for the Study of Adrenal Tumors (ENSAT), somatic mutations in KCNJ5, CACNAID, ATPIA1 and ATP2B3 genes were identified in 38%, 9.3%, 5.3% and 1.7% of APAs, respectively (16). In 2018, Nanba et al. (34) investigated the prevalence of somatic mutations in APAs guided by the aldosterone synthase (CYP11B2) staining in white Americans. The most frequently mutated gene was KCNJ5 (43%), followed by CACNAID (21%), ATP1A1 (17%), ATP2B3 (4%), and CTNNB1 (3%). Although this approach guided by microdissection of CYP11B2 positive areas increased the frequency of CACNAID and ATPIAI somatic mutations, it did not significantly change the percentage of KCNJ5 mutant APAs. In our study, a target approach of CYP11B2 positive areas was not performed to guide DNA extraction. But, since we were focused on KCNJ5 mutations and clinical outcome, the absence of a CYP11B2 guided approach did not impact our results.

The impact of KCNJ5 somatic mutations on clinical outcome after adrenalectomy brings new insight about the post-operative follow-up of PA patients. Based on our findings, patients with unilateral hyperplasia and APAs with WT KCNJ5 should be closely monitored during the post-operative period, because they are more likely to require ongoing anti- hypertensive medications. Genetic screening for KCNJ5 somatic mutations can be rapidly performed after surgery in clinical practice, since almost the totality of KCNJ5 somatic mutations described so far can be identified by a single PCR reaction and automated Sanger sequencing. Indeed, two KCNJ5 somatic mutations (p.Gly151Arg and p.Leu168Arg) account for 98% of KCNJ5 genetic mutations in APAs (16).

Recently, a steroid metabolome analysis revealed prevalent glucocorticoid excess in PA (35). Postoperative evidence of adrenal insufficiency was found in 29% of tested patients (35). In addition, cortisol excess appears to have an additional impact on cardiac remodeling and metabolic parameters in PA patients (36,37). In our study, we investigated cortisol secretion in only 15 PA patients. Cortisol levels after LDDST did not correlate with HT remission, but the number of patients investigated for cortisol secretion was small. We are currently investigating cortisol secretion in all PA patients. In a recent Chinese cohort of APAs, cortisol co-secretion (defined by a cortisol >1.8 ug/dL after LDDST) was identified in

ADVANCE ARTICLE: JCEM

ENDOCRINE SOCIETY

22 out of 555 PA patients (38). Aldosterone and cortisol co-secreting adenomas were larger and associated with more cardiovascular and metabolic complications. However, HT remission without any antihypertensive medication was unexpectedly evidenced in all cases with cortisol secretion (38).

Although the retrospective design has the potential for selection bias, a strong aspect of our study was the precise definition of complete biochemical success using PASO criteria, allowing a better assessment of KCNJ5 mutation status in clinical outcome. In conclusion, we demonstrated here that KCNJ5 somatic mutation was an independent predictor of HT remission after unilateral adrenalectomy in patients with unilateral PA.

Sources of Funding: Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) Grant number 2015/17049-8 (to M.Q.A.); Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) Grant number 403256/2016-0 (to MQA).

Fundação de Amparo à Pesquisa do Estado de São Paulo http://dx.doi.org/10.13039/501100001807, 2015/17049-8, Madson Q Almeida; Conselho Nacional de Desenvolvimento Científico e Tecnológico http://dx.doi.org/10.13039/501100003593, 403256/2016-0, Madson Q Almeida

Conflict(s) of Interest/Disclosure(s): The authors have nothing to disclose Data Availability: HE

Corresponding author (and person to whom reprint requests should be

addressed): Madson Q. Almeida, MD, Unidade de Suprarrenal e Endocrinologia do Desenvolvimento, Laboratório de Hormônios e Genética Molecular LIM-42, Hospital das Clínicas e Instituto do Câncer (ICESP), Faculdade de Medicina da Universidade de São Paulo, Av. Dr. Enéas de Carvalho Aguiar, 155, 2 andar Bloco 6, 05403-900, São Paulo, SP, Brasil; Phone: 55 11 26617512; Fax: 55 11 26617519; E-mail: madson.a@hc.fm.usp.br

The datasets generated during and/or analyzed during the current study are not publicly available but are available from the corresponding author on reasonable request.

References

1. Funder JW, Carey RM, Mantero F, Murad MH, Reincke M, Shibata H, Stowasser M, Young WF, Jr. The Management of Primary Aldosteronism: Case Detection, Diagnosis, and Treatment: An Endocrine Society Clinical Practice Guideline. The Journal of clinical endocrinology and metabolism. 2016;101(5):1889-1916.

2. Milliez P, Girerd X, Plouin PF, Blacher J, Safar ME, Mourad JJ. Evidence for an increased rate of cardiovascular events in patients with primary aldosteronism. J Am Coll Cardiol. 2005;45(8):1243-1248.

3. Savard S, Amar L, Plouin PF, Steichen O. Cardiovascular complications associated with primary aldosteronism: a controlled cross-sectional study. Hypertension. 2013;62(2):331-336.

4. Monticone S, D’Ascenzo F, Moretti C, Williams TA, Veglio F, Gaita F, Mulatero P. Cardiovascular events and target organ damage in primary aldosteronism compared with essential hypertension: a systematic review and meta-analysis. Lancet Diabetes Endocrinol. 2018;6(1):41-50.

5. Rossi GP, Bernini G, Caliumi C, Desideri G, Fabris B, Ferri C, Ganzaroli C, Giacchetti G, Letizia C, Maccario M, Mallamaci F, Mannelli M, Mattarello MJ, Moretti A, Palumbo G, Parenti G, Porteri E, Semplicini A, Rizzoni D, Rossi E, Boscaro M, Pessina AC,

Mantero F. A prospective study of the prevalence of primary aldosteronism in 1,125 hypertensive patients. J Am Coll Cardiol. 2006;48(11):2293-2300.

6. Rossi GP, Cesari M, Cuspidi C, Maiolino G, Cicala MV, Bisogni V, Mantero F, Pessina AC. Long-term control of arterial hypertension and regression of left ventricular hypertrophy with treatment of primary aldosteronism. Hypertension. 2013;62(1):62-69.

7. Sukor N, Kogovsek C, Gordon RD, Robson D, Stowasser M. Improved quality of life, blood pressure, and biochemical status following laparoscopic adrenalectomy for unilateral primary aldosteronism. The Journal of clinical endocrinology and metabolism. 2010;95(3):1360-1364.

8. Meyer A, Brabant G, Behrend M. Long-term follow-up after adrenalectomy for primary aldosteronism. World J Surg. 2005;29(2):155-159.

9. Sawka AM, Young WF, Thompson GB, Grant CS, Farley DR, Leibson C, van Heerden JA. Primary aldosteronism: factors associated with normalization of blood pressure after surgery. Ann Intern Med. 2001;135(4):258-261.

10. Celen O, O’Brien MJ, Melby JC, Beazley RM. Factors influencing outcome of surgery for primary aldosteronism. Arch Surg. 1996;131(6):646-650.

11. Streeten DH, Anderson GH, Jr., Wagner S. Effect of age on response of secondary hypertension to specific treatment. Am J Hypertens. 1990;3(5 Pt 1):360-365.

12. Choi M, Scholl UI, Yue P, Bjorklund P, Zhao B, Nelson-Williams C, Ji W, Cho Y, Patel A, Men CJ, Lolis E, Wisgerhof MV, Geller DS, Mane S, Hellman P, Westin G, Akerstrom G, Wang W, Carling T, Lifton RP. K+ channel mutations in adrenal aldosterone- producing adenomas and hereditary hypertension. Science. 2011;331(6018):768-772.

13. Scholl UI, Goh G, Stolting G, de Oliveira RC, Choi M, Overton JD, Fonseca AL,

Korah R, Starker LF, Kunstman JW, Prasad ML, Hartung EA, Mauras N, Benson MR, Brady T, Shapiro JR, Loring E, Nelson-Williams C, Libutti SK, Mane S, Hellman P, Westin G, Akerstrom G, Bjorklund P, Carling T, Fahlke C, Hidalgo P, Lifton RP. Somatic and germline CACNA1D calcium channel mutations in aldosterone-producing adenomas and primary aldosteronism. Nat Genet. 2013;45(9):1050-1054.

14. Beuschlein F, Boulkroun S, Osswald A, Wieland T, Nielsen HN, Lichtenauer UD, Penton D, Schack VR, Amar L, Fischer E, Walther A, Tauber P, Schwarzmayr T, Diener S, Graf E, Allolio B, Samson-Couterie B, Benecke A, Quinkler M, Fallo F, Plouin PF, Mantero F, Meitinger T, Mulatero P, Jeunemaitre X, Warth R, Vilsen B, Zennaro MC, Strom TM, Reincke M. Somatic mutations in ATP1A1 and ATP2B3 lead to aldosterone-producing adenomas and secondary hypertension. Nat Genet. 2013;45(4):440-444, 444e441-442.

15. Azizan EA, Poulsen H, Tuluc P, Zhou J, Clausen MV, Lieb A, Maniero C, Garg S, Bochukova EG, Zhao W, Shaikh LH, Brighton CA, Teo AE, Davenport AP, Dekkers T, Tops B, Kusters B, Ceral J, Yeo GS, Neogi SG, McFarlane I, Rosenfeld N, Marass F, Hadfield J, Margas W, Chaggar K, Solar M, Deinum J, Dolphin AC, Farooqi IS, Striessnig J, Nissen P, Brown MJ. Somatic mutations in ATP1A1 and CACNA1D underlie a common subtype of adrenal hypertension. Nat Genet. 2013;45(9):1055-1060.

16. Fernandes-Rosa FL, Williams TA, Riester A, Steichen O, Beuschlein F, Boulkroun S, Strom TM, Monticone S, Amar L, Meatchi T, Mantero F, Cicala MV, Quinkler M, Fallo F, Allolio B, Bernini G, Maccario M, Giacchetti G, Jeunemaitre X, Mulatero P, Reincke M, Zennaro MC. Genetic spectrum and clinical correlates of somatic mutations in aldosterone- producing adenoma. Hypertension. 2014;64(2):354-361.

17. Okamura T, Nakajima Y, Katano-Toki A, Horiguchi K, Matsumoto S, Yoshino S, Yamada E, Tomaru T, Ishii S, Saito T, Ozawa A, Shibusawa N, Satoh T, Okada S, Nagaoka R, Takada D, Horiguchi J, Oyama T, Yamada M. Characteristics of Japanese aldosterone- producing adenomas with KCNJ5 mutations. Endocr J. 2017;64(1):39-47.

ENDOCRINE SOCIETY

18. Teo AE, Garg S, Shaikh LH, Zhou J, Karet Frankl FE, Gurnell M, Happerfield L, Marker A, Bienz M, Azizan EA, Brown MJ. Pregnancy, Primary Aldosteronism, and Adrenal CTNNB1 Mutations. N Engl J Med. 2015;373(15):1429-1436.

19. Arnesen T, Glomnes N, Stromsoy S, Knappskog S, Heie A, Akslen LA, Grytaas M, Varhaug JE, Gimm O, Brauckhoff M. Outcome after surgery for primary hyperaldosteronism may depend on KCNJ5 tumor mutation status: a population-based study from Western Norway. Langenbecks Arch Surg. 2013;398(6):869-874.

20. Ip JC, Pang TC, Pon CK, Zhao JT, Sywak MS, Gill AJ, Soon PS, Sidhu SB. Mutations in KCNJ5 determines presentation and likelihood of cure in primary hyperaldosteronism. ANZ J Surg. 2015;85(4):279-283.

21. Wu VC, Wang SM, Chueh SJ, Yang SY, Huang KH, Lin YH, Wang JJ, Connolly R, Hu YH, Gomez-Sanchez CE, Peng KY, Wu KD. The prevalence of CTNNB1 mutations in primary aldosteronism and consequences for clinical outcomes. Sci Rep. 2017;7:39121.

22. Williams TA, Lenders JWM, Mulatero P, Burrello J, Rottenkolber M, Adolf C, Satoh F, Amar L, Quinkler M, Deinum J, Beuschlein F, Kitamoto KK, Pham U, Morimoto R, Umakoshi H, Prejbisz A, Kocjan T, Naruse M, Stowasser M, Nishikawa T, Young WF, Jr., Gomez-Sanchez CE, Funder JW, Reincke M, Primary Aldosteronism Surgery Outcome i. Outcomes after adrenalectomy for unilateral primary aldosteronism: an international consensus on outcome measures and analysis of remission rates in an international cohort. Lancet Diabetes Endocrinol. 2017.

23. Vilela LAP, Almeida MQ. Diagnosis and management of primary aldosteronism. Arch Endocrinol Metab. 2017;61(3):305-312.

24. Nanba K, Tamanaha T, Nakao K, Kawashima ST, Usui T, Tagami T, Okuno H, Shimatsu A, Suzuki T, Naruse M. Confirmatory testing in primary aldosteronism. The Journal of clinical endocrinology and metabolism. 2012;97(5):1688-1694.

25. Lim V, Guo Q, Grant CS, Thompson GB, Richards ML, Farley DR, Young WF, Jr. Accuracy of adrenal imaging and adrenal venous sampling in predicting surgical cure of primary aldosteronism. The Journal of clinical endocrinology and metabolism. 2014;99(8):2712-2719.

26. Williams B, Mancia G, Spiering W, Agabiti Rosei E, Azizi M, Burnier M, Clement DL, Coca A, de Simone G, Dominiczak A, Kahan T, Mahfoud F, Redon J, Ruilope L, Zanchetti A, Kerins M, Kjeldsen SE, Kreutz R, Laurent S, Lip GYH, McManus R, Narkiewicz K, Ruschitzka F, Schmieder RE, Shlyakhto E, Tsioufis C, Aboyans V, Desormais I, Group ESCSD. 2018 ESC/ESH Guidelines for the management of arterial hypertension. Eur Heart J. 2018;39(33):3021-3104.

27. Malachias MVB, Gomes MAM, Nobre F, Alessi A, Feitosa AD, Coelho EB. 7th Brazilian Guideline of Arterial Hypertension: Chapter 2 - Diagnosis and Classification. Arq Bras Cardiol. 2016;107(3 Suppl 3):7-13.

28. Heaton JH, Wood MA, Kim AC, Lima LO, Barlaskar FM, Almeida MQ, Fragoso MCBV, Kuick R, Lerario AM, Simon DP, Soares IC, Starnes E, Thomas DG, Latronico AC, Giordano TJ, Hammer GD. Progression to Adrenocortical Tumorigenesis in Mice and Humans through Insulin-Like Growth Factor 2 and beta-Catenin. Am J Pathol. 2012;181(3):1017-1033.

29. Charmandari E, Sertedaki A, Kino T, Merakou C, Hoffman DA, Hatch MM, Hurt DE, Lin L, Xekouki P, Stratakis CA, Chrousos GP. A novel point mutation in the KCNJ5 gene causing primary hyperaldosteronism and early-onset autosomal dominant hypertension. The Journal of clinical endocrinology and metabolism. 2012;97(8):E1532-1539.

30. Lenzini L, Rossitto G, Maiolino G, Letizia C, Funder JW, Rossi GP. A Meta-Analysis of Somatic KCNJ5 K(+) Channel Mutations In 1636 Patients With an Aldosterone-Producing Adenoma. The Journal of clinical endocrinology and metabolism. 2015;100(8):E1089-1095.

ADVANCE ARTICLE: JCEM

ENDOCRINE SOCIETY

31. Rossi GP, Bolognesi M, Rizzoni D, Seccia TM, Piva A, Porteri E, Tiberio GA, Giulini SM, Agabiti-Rosei E, Pessina AC. Vascular remodeling and duration of hypertension predict outcome of adrenalectomy in primary aldosteronism patients. Hypertension. 2008;51(5):1366-1371.

32. Nanba K, Omata K, Gomez-Sanchez CE, Stratakis CA, Demidowich AP, Suzuki M, Thompson LDR, Cohen DL, Luther JM, Gellert L, Vaidya A, Barletta JA, Else T, Giordano TJ, Tomlins SA, Rainey WE. Genetic Characteristics of Aldosterone-Producing Adenomas in Blacks. Hypertension. 2019:HYPERTENSIONAHA11812070.

3. Kitamoto T, Omura M, Suematsu S, Saito J, Nishikawa T. KCNJ5 mutation as a predictor for resolution of hypertension after surgical treatment of aldosterone-producing adenoma. J Hypertens. 2018;36(3):619-627.

34. Nanba K, Omata K, Else T, Beck PCC, Nanba AT, Turcu AF, Miller BS, Giordano TJ, Tomlins SA, Rainey WE. Targeted Molecular Characterization of Aldosterone-Producing Adenomas in White Americans. The Journal of clinical endocrinology and metabolism. 2018;103(10):3869-3876.

35. 5. Arlt W, Lang K, Sitch AJ, Dietz AS, Rhayem Y, Bancos I, Feuchtinger A, Chortis V, Gilligan LC, Ludwig P, Riester A, Asbach E, Hughes BA, O’Neil DM, Bidlingmaier M, Tomlinson JW, Hassan-Smith ZK, Rees DA, Adolf C, Hahner S, Quinkler M, Dekkers T, Deinum J, Biehl M, Keevil BG, Shackleton CHL, Deeks JJ, Walch AK, Beuschlein F, Reincke M. Steroid metabolome analysis reveals prevalent glucocorticoid excess in primary aldosteronism. JCI Insight. 2017;2(8).

36. . Adolf C, Kohler A, Franke A, Lang K, Riester A, Low A, Heinrich DA, Bidlingmaier M, Treitl M, Ladurner R, Beuschlein F, Arlt W, Reincke M. Cortisol Excess in Patients With Primary Aldosteronism Impacts Left Ventricular Hypertrophy. The Journal of clinical endocrinology and metabolism. 2018;103(12):4543-4552.

37. Gerards J, Heinrich DA, Adolf C, Meisinger C, Rathmann W, Sturm L, Nirschl N, Bidlingmaier M, Beuschlein F, Thorand B, Peters A, Reincke M, Roden M, Quinkler M. Impaired Glucose Metabolism in Primary Aldosteronism is Associated With Cortisol Co- Secretion. The Journal of clinical endocrinology and metabolism. 2019.

38. Tang L, Li X, Wang B, Ma X, Li H, Gao Y, Gu L, Nie W, Zhang X. Clinical Characteristics of Aldosterone- and Cortisol-Coproducing Adrenal Adenoma in Primary Aldosteronism. Int J Endocrinol. 2018;2018:4920841.

Figure 1. Flow chart for study cohort: 100 patients with unilateral PA met the inclusion criteria and were enrolled in this analysis. CT, computed tomography; AVS, adrenal venous sampling. Figure 2. Electropherograms of KCNJ5 somatic mutations in APAs. KCNJ5 somatic mutations were identified in 33 out of 76 (43.4%) cases: p.Gly151Arg (n= 17), p.Leu168Arg (n= 15) and p.Glu145GIn (n= 1). APAs, aldosterone-producing adenomas Table 1. Clinical and biochemical characteristics of patients with unilateral PA according HT cure after adrenalectomy.
Hypertension cure (n= 37)No Hypertension cure (n= 63)p
Female gender73%47.6%0.042
Age at diagnosis (yr)*47 (25-68)50 (20 - 74)0.32
Familial history of HT45.9%46%0.99
<3 Drugs for HT treatment48.6%15.9%0.0001
Hypokalemia86.4%81%0.49
BMI <25 kg/m258.3%39.7%0.073
HT duration <10 yrs64.9%39.7%0.015
Aldosterone (ng/dL)*34.8 (11.7-195)30 (12.1 - 127)0.37
A/PRA ratio*198 (37.7- 1466)162 (34-977)0.64

THE JOURNAL OF CLINICAL ENDOCRINOLOGY & METABOLISM

ADVANCE ARTICLE: JCEM

ENDOCRINE SOCIETY

A/R ratio*17.2 (3.1-121.8)17 (2.9 - 79.4)0.88
Nodule size (cm)*2.0 (0.7- 5)1.6 (0.4-9.1)0.25
Follow-up (m)*24 (6-201)36 (6-252)0.09

PA, primary aldosteronism; HT, hypertension; BMI, body mass index; A, aldosterone; R, renin. *Median (range)

Table 2. Clinical and biochemical characteristics of patients with unilateral PA according KCNJ5 mutational status.
Mutant KCNJ5 (n= 33)WT KCNJ5 (n= 43)p
Female gender72.7%39.5%0.004
Age at diagnosis (yr)*44 (20-68)52 (33 - 74)0.059
Familial history of HT60.6%48.8%0.31
<3 Drugs for HT treatment27.3%18.6%0.37
Hypokalemia84.4%75%0.33
BMI <25 kg/m254.5%35.7%0.1
HT duration <10 yrs57.6%39.5%0.11
Aldosterone (ng/dL)*31.9 (15.2 - 195)27.5 (11.7-84.2)0.16
A/PRA ratio*209 (66.4 - 1466)139 (34.5- 633)0.06
A/R ratio*17.9 (5.5-121.8)12.4 (2.9-52.6)0.12
Nodule size (cm)*2.0 (0.7 - 4.0)1.3 (0.7-9.1)0.001
HT cure57.6%16.2%0.0001
Follow-up (m)25 (6 - 76)24 (6 - 75)0.77

PA, primary aldosteronism; HT, hypertension; BMI, body mass index; A, aldosterone; R, renin; PRA, plasma renin activity.

*Median (range)

Table 3. Multivariate analysis of predictive factors of HT remission in patients with unilateral PA after adrenalectomy.
Relative risk95% Confidence intervalp
Female gender1.550.39 -6.20.53
BMI <25 kg/m21.530.43 - 5.50.51
Age at diagnosis <50 yrs*0.740.16 - 3.450.7
HT duration <10 yrs1.030.26 - 4.040.96
<3 medications for HT3.010.75 - 12.130.12
Nodule size >1.6 cm*1.190.34 - 4.180.79
KCNJ5 mutation6.481.83 - 22.930.004

PA, primary aldosteronism; HT, hypertension; BMI, body mass index.

*Median values of age and nodule size

ADVAR

ADVANCE ARTICLE: JCEM

ENDOCRINE SOCIETY

V

CLE

145 patients with unilateral PA underwent unilateral adrenalectomy (guided by CT or AVS)

- 27 patients excluded: absence of biochemical re-evaluation in post-operative follow-up - 10 did not cure PA

108 patients with complete biochemical success according Primary Aldosteronism Surgical Outcome (PASO) criteria

CZ

8 patients excluded: < 6 months of follow-up to re- evaluate blood pressure

100 patients enrolled in this study:

- 90 aldosterone-producing adenomas (APAs)

- 1 aldosterone-producing carcinoma

- 9 unilateral hyperplasias

ADV

AL

KCNJ5 somatic mutations

Normal control

D09_KCNJ5-R_2A Fragment base #593. Base 174 of 603

A

A

p.L168R (n= 15)

. HOS_KCNJ5-2R_136 Fragment base #593. Base 166 of 606 . ATTATACT CCKCTTGGTCCAG TRATATaA a a Ma A AJ JA 8 8 1 )

T/G

Normal control
D09_KCNJS-R_2A Fragment base #541. Base 122 of 602 AACAACCATTGGGTATGGCTT
p.G151R (n= 17)
. B09_KCNJ5-2R_146 Fragment base #541. Base 123 of 616 . AACAACCATTRGGTATGGCTT
G/A ou C

Normal control

GOS_KCNJ5-2F_173 Fragment base #5. Base 09 of 609

TTCTCCATTGAGACCGAAAC

TTCTCCATIGAG ACC GARAC

p.E145Q (n= 1)

DOS KCNJS-2F 182_UEG 2018-12-13 Fragment base #823. Base 05 of 005 TTCTCCATTGAG ACCG AAAC TTCTCCATIGAGACCG ARAC

G/C