BENTHAM SCIENCE
REVIEW ARTICLE
Effects of Adipocyte-derived Factors on the Adrenal Cortex
Current
Molecular Pharmacology
e
COX
MM
6
AE
IMI & SHEA
MAMPS
IL-6 NO
IL-B
L-A
Hiroki Shimada, Erika Noro, Susumu Suzuki, Jun Sakamoto, Ikuko Sato, Rehana Parvin, Atsushi Yokoyama and Akira Sugawara
Department of Molecular Endocrinology, Tohoku University Graduate School of Medicine, Sendai 980-8575, Miyagi, Japan
Abstract: Background and Objective: Obesity is highly complicated by hypertension and hyperglyce- mia. In particular, it has been proposed that obesity-related hypertension is caused by adipocyte-derived factors that are recognized as undetermined proteins secreted from adipocytes. Adipocyte-derived fac- tors have been known to be related to aldosterone secretion in the adrenal gland. So far, Wnt proteins, CTRP-1, VLDL, LDL, HDL and leptin have been demonstrated to stimulate aldosterone secretion. In contrast, it has not yet been clarified whether adipocyte-derived factors also affect adrenal cortisol se- cretion.
ARTICLE HISTORY
Received: February 20, 2019
Revised: August 20, 2019
Accepted: September 18, 2019
DOI: 10.2174/1874467212666191015161334
Methods and Results: In the present study, we investigated the effect of adipocyte-derived factors on cortisol synthase gene CYP11B1 mRNA expression in vitro study using adrenocortical carcinoma H295R cells and mouse fibroblast 3T3-L1cells. Interestingly, adipocyte-derived factors were demon- strated to have the ability to stimulate CYP11B1 mRNA expression.
CrossMark
Conclusion: Since CYP11B1 is well known as a limiting enzyme of cortisol synthesis, our study sug- gests that adipocyte-derived factors may stimulate cortisol secretion, as well as aldosterone secretion. Taken together, adipocyte-derived factors may be the cause of metabolic syndrome due to their stimu- lating effects on aldosterone/cortisol secretion. Therefore, the innovation of novel drugs against them may possibly be a new approach against metabolic syndrome.
Current Molecular Pharmacology
Keywords: Obesity, adipocyte, adrenal, CYP11B1, CYP11B2, cortisol.
1. INTRODUCTION
Obesity is associated with metabolic dysfunction, hyper- glycemia, hyperlipidemia, and hypertension. In particular, obese patients are well known to be highly complicated with hypertension which is known as “obesity-related hyperten- sion.” In general, the systemic blood pressure is controlled by the renin-angiotensin-aldosterone system (RAAS). An- giotensin II stimulates zona glomerulosa (ZG) in the adrenal cortex and, thereafter, steroid acute regulatory protein (StAR) and aldosterone synthase (CYP11B2) are upregu- lated. Recently, adipocyte-derived factors, which are recog- nized as undetermined proteins secreted from adipocytes, have been recognized as one of the stimuli of the adrenal ZG independently of angiotensin II. However, there has been no report that adipocyte-derived factors stimulate adrenal zona fasciculata (ZF) or zona reticularis (ZR). In this review, we focused on the adipocyte-derived factors as adrenal gland stimuli, and investigate whether they have a potential role(s) as cortisol secretagogues in ZF.
2. ADIPOCYTE-DERIVED FACTORS PLAY A ROLE(S) AS ALDOSTERONE SECRETAGOGUES IN ADRENAL ZG
The systemic blood pressure is well-known to be regu- lated by RAAS. Aldosterone maintains the fluid and electro- lyte balance in the whole human body. Angiotensin II and potassium ion are well-known as aldosterone secretagogues in the adrenal ZG. Angiotensin II and potassium stimulate calcium signals in ZG cells, and then they upregulate the rate-limiting enzyme genes of aldosterone secretion, StAR gene and aldosterone synthase gene (CYP11B2) expression. At first, it was reported that adipocyte-derived factors stimu- lated StAR gene expression [1]. In this paper, it is suggested that the adipocyte-derived factors are proteins that have a potential role in aldosterone secretion in vitro. Secondly, it has been reported that SHR-LepreP rats demonstrate adrenal Star, Cyp11b2 at the mRNA level and that the serum aldos- terone level is higher than that in SHR rats in 2006 [2]. SHR- LepreP rats exhibit obesity complicated with hypertension as a metabolic syndrome model. These reports suggested the presence of obesity-related hypertension. Since the first pa- per was published, researchers have sought the adipocyte- derived factors that stimulate aldosterone secretion. The adi- pocyte is not only a storage device of lipids, but is also a
*Address correspondence to this author at the Department of Molecular Endocrinology, Tohoku University Graduate School of Medicine, Sendai 980-8575, Miyagi, Japan; Tel: +81 (22) 717-7483;
E-mail: akras2i@med.tohoku.ac.jp
Effects of Adipocyte-derived Factors on the Adrenal Cortex
secretory organ. Although adipose tissue secretes several cytokines (e.g. IL-6, TNF-a and others), the well-known cytokines IL-6 and TNF-a lack the ability to stimulate aldos- terone secretion. Recently, it has been reported that Wnt pro- teins [3], CTRP-1 [4], VLDL [5], LDL, HDL [6] and leptin [7] have the ability to stimulate aldosterone secretion.
3. WINGLESS-TYPE MMTV INTEGRATION SITE (WNT) PROTEIN FAMILY
Wingless-type MMTV integration site (Wnt) proteins are glycolipid proteins involved in the development and cell differentiation, survival and proliferation [8]. Wnt gene was first isolated from a mouse mammary tumor as Int-1 [9]. Currently, 19 kinds of Wnt protein have been identified. Wnt proteins bind to the Wnt protein receptor frizzled and then ß-catenin is activated as a transcriptional factor. Wnt protein is known to be related to adrenal differentiation. Recently, it has been reported that the adrenal cortex develops from ad- renal progenitor cells localized in adrenal ZG [10, 11]. WNT4 is secreted from the adrenal capsule and then WNT4 induces adrenocortical progenitor cells into adrenal ZG cells [12]. Adrenal cortex progenitor cells do not have the ability to secrete aldosterone. In contrast, adrenal ZG cells can se- crete aldosterone. Thus, WNT4 enables adrenocortical pro- genitor cells to secrete aldosterone. In addition, WNT4 in- hibits the conversion of adrenal ZG cells to ZF cells. WNT4 activates ß-catenin in ZG cells, and ß-catenin sustains ZG cells through the expression of angiotensin type 1 receptor (AT1R). Therefore, WNT4 not only converts adrenal pro- genitor cells to aldosterone secretory cells, but also inhibits the conversion of ZG cells to ZF/ZR cells. It has been re- ported that WNT3A and WNT10B are secreted from adipo- cytes and activate ß-catenin in adrenocortical carcinoma cell line H295R [3]. As a result, WNT3A and WNT10B have the ability to stimulate StAR mRNA expression and aldosterone secretion. In this paper, the authors have described how WNT3A and WNT10B-related aldosterone secretion is in- hibited by Wnt protein inhibitor soluble frizzled-related pro- tein 1 (SFRP-1). However, it has been reported that ß- catenin is mutated into a continuously active form in H295R cells [13], which means that ß-catenin is already activated in H295R cells without Wnt protein. Whether WNT3A and WNT10B have the ability to stimulate aldosterone secretion is still a controversial issue. Moreover, it is considered that Wnt proteins have the ability to stimulate aldosterone secre- tion, though the molecular mechanism of Wnt protein related to aldosterone secretion is unclear. Thus, it is necessary to prove that Wnt proteins are adipocyte-derived proteins that directly stimulate aldosterone secretion.
4. COMPLEMENT-C1Q-TNF RELATED PROTEIN (CTRP) FAMILY
Recently, 15 members of complement-C1q-TNF related protein (CTRP) family proteins were detected [14]. CTRP is similar to complement related factor, C1q. Generally, CTRP family proteins form dimers, trimers, and multimers with other CTRP proteins and adiponectin. Especially, CTRP-1 was reported to have the ability to secrete aldosterone [4].
CTRP-1 mRNA is known to be expressed in heart, placenta, liver and muscle. Since CTRP-1 has been reported
to reduce the serum glucose level, it has therefore been speculated that CTRP-1 is related to several metabolic disor- ders [14, 15]. Moreover, it has been reported that CTRP-1 increases the intracellular calcium concentration and stimu- lates adrenal CYP11B2 mRNA expression [4]. However, in this study, Ctrp-1 mRNA was not detected in mouse adipo- cytes. In contrast, CTRP-1 mRNA is highly expressed in adrenal ZG [4]. CTRP-1 activates the serine/threonine kinase PKB/Akt and mitogen-activated protein kinase (MAPK) p42/44 ERK1/2 signaling in mouse myocytes [4]. Therefore, it is speculated that CTRP-1 activates PKB/Akt and p42/44 ERK1/2 in adrenal ZG cells. Moreover, knockdown of CTRP-1 in human adrenocortical carcinoma H295R cells reduces basal and angiotensin II-stimulated aldosterone se- cretion [4]. It is controversial whether serum CTRP-1 stimu- lates adrenal aldosterone secretion.
CTRP3 is also a secreted protein derived from adipo- cytes. CTRP-3 binds to lysosomal-associated membrane protein (LAMP-1), and is suggested to improve non- alcoholic fatty liver disease (NAFLD) [16]. LAMP-1 is ex- pressed in a wide variety of tissues and commonly used as a lysosomal protein marker. Although expression of LAMP-1 has not been reported in the adrenal cortex, it is highly pos- sible that LAMP-1 is also expressed there. Therefore, CTRP- 3 may play some roles in the adrenal cortex.
Some CTRP proteins are thus speculated to be involved in adrenal steroidogenesis although more studies are needed to prove if CTRP proteins have the ability to stimulate aldos- terone secretion.
5. VLDL, LDL, HDL
Very Low-Density Lipoproteins (VLDL) are a class of large lipoproteins synthesized in the liver. It is known that VLDL bind VLDL receptor and that VLDL particles are taken up through the endocytic process. It has been reported that VLDL have the ability to stimulate StAR, CYP11B2 mRNA expres- sion and aldosterone secretion [5]. In this paper, VLDL stimu- lated aldosterone secretion through elevating the intracellular calcium level. The authors suggested that it was important that the VLDL-induced aldosterone secretion depended on calcium signaling in experiments using the calcium channel blocker nifedipine or the calcium/calmodulin kinase inhibitor KN-93. Moreover, VLDL-induced CYP11B2 mRNA expression was associated with cAMP inducer forskolin-induced CYP11B2 mRNA expression but not angiotensin II using H295R cells. In this result, the cascade of VLDL-induced aldosterone secre- tion was similar to the cascade of angiotensin I- induced aldos- terone secretion. It has been suggested that low-density lipo- proteins (LDL) and high-density lipoproteins (HDL) stimulate CYP11B2 mRNA expression [6, 17]. However, it is controver- sial whether lipoproteins have the ability to stimulate aldoster- one secretion [18].
6. LEPTIN
Leptin is one of the most well-known adipocyte-secreted cytokines. It is known that leptin acts on the central nervous system and represses food intake. It was reported that leptin has the ability to stimulate CYP11B2 mRNA expression and aldosterone secretion [7]. In this paper, the authors focused on female leptin receptor-mutated db/db mice. These mice
do not demonstrate obesity-related hypertension. The authors speculated that leptin causes obesity-related hypertension. Recently, it was suggested that leptin-related adrenal aldos- terone secretion is only expressed in female mice [19]. In contrast, db/db male mice show increased adrenal CYP11B2 mRNA expression and serum aldosterone levels [20]. Thus, it is suggested that obesity-related hypertension involves several mechanisms. Moreover, it is speculated that sexual differences exist in the obesity-related hypertension. Cur- rently, the mechanism that underlies the leptin-related aldos- terone secretion is unknown.
7. ADIPOCYTE-DERIVED FACTORS RELATED TO CYP11B1 GENE EXPRESSION
It is well-known that adipocyte-derived factors are related to CYP11B2 gene expression and aldosterone secretion. In contrast, the adipocyte-derived factors related to cortisol secre- tion are poorly understood. Cortisol, one of the most famous glucocorticoid hormones, regulates the serum glucose level and gluconeogenesis and is deeply related to diabetes and glu- cose metabolism dysfunction. Cortisol is secreted in the adre- nal ZF, which induces adrenocorticotropic hormone (ACTH). ACTH binds to melanocortin type 2 receptor (MC2R), which induces activating adenylate cyclase (AC), and then the intra- cellular cyclic adenine monophosphate (cAMP) level is in- creased. cAMP activates the cAMP response element-binding protein (CREB) and several other transcriptional factors that stimulate cortisol synthase gene CYP11B1 mRNA expression and cortisol synthesis. CYP11B1 is well known as a limiting enzyme of cortisol synthesis. Glucocorticoid is a positive regulator in adipogenesis, suggesting that adrenal steroi- dogenesis is related to obesity. Wnt proteins have the ability to stimulate cortisol secretion in H295R cells. On the other hand, Wnt proteins and leptin are known to have inhibitory effects on cortisol secretion in vivo [12, 21, 22].
In this paper, we investigated the possible existence of obesity-related adrenal cortisol synthesis. We first differenti- ated mouse fibroblast 3T3-L1 cells into adipocytes using insulin, dexamethasone (DEX), 1-3-isobutylmethylxantine (IBMX), and pioglitazone for 2 days. We next changed the medium to the maintenance medium that included insulin and collected the supernatants. The supernatants were then incubated with human adrenocortical carcinoma H295R cells for 12 hours, and their ability to stimulate CYP11B1 mRNA expression was determined by RT-qPCR using RNA ex- tracted from H295R cells. As a result, we found that adipo- cyte-derived factors have the ability to stimulate CYP11B1 mRNA expression (Fig. 1A). Generally, an increase in the intracellular cAMP level in ZF is important for CYP11B1 mRNA expression and cortisol synthesis. In this result, there appeared to be a novel relationship between adipocyte- derived factors and adrenal ZF. Moreover, in the db/db mice, the adrenal Cyp11b1 mRNA and serum corticosterone levels were high. Thus, it is speculated that adipocyte-derived fac- tors have the ability to stimulate adrenal cortisol secretion (Fig. 1B). H295R cells are known to have a constitutional active gene mutation in ß-catenin [13]. In this study, we could not exclude the possibility of the involvement of ß - catenin mutation in CYP11B1 expression in H295R cells. Further studies are needed to clarify this possibility.
A
CYP11B1/GAPDH
*
2
*
1.8
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0
Ctrl
Forskolin
Differentiation medium
Day2
Day4
B
Adipocyte
?
?
Undetermined factors
CYP11B1
Effects of Adipocyte-derived Factors on the Adrenal Cortex
transcription to synthesize cDNA using PrimeScript Reverse Tran- scriptase (Takara Bio, Tokyo, Japan) and quantitative polymerase chain reaction (RT-qPCR) was thereafter performed using primers shown in Table 1. (B) Graphical highlight in adipocyte-derived factors stimulate adrenal CYP11B1 mRNA expression.
| Target Gene | Sequence |
|---|---|
| hGAPDH_F | atcccatcaccatettccag |
| hGAPDH_R | atgagtccttccacgatacc |
| hCYP11B1_F | ggcagaggcagagatgctg |
| hCYP11B1_R | ttctgggttagtgtctccacctg |
| hCYP11B1 Probe | [6-FAM] tgctgcaccatgtgctgaaacacct [TAMRA6-FAM] |
CONCLUSION
The adipocyte-derived factors related to adrenal CYP11B2 mRNA expression and aldosterone secretion are well-known. For the experiments concerning adrenal aldos- terone secretion, most authors of the previous reports used H295R cells, since the cells have the ability to secrete abun- dant aldosterone, in response to angiotensin II, compared to other adrenocortical cell lines [23]. However, since H295R cells are known to have active ß-catenin mutation, we need to pay attention to the effect of its mutation when we per- form adrenal aldosterone production experiments using these cells [13]. On the other hand, it is suggested that the adipo- cyte-derived factors affect not only aldosterone synthesis but also cortisol synthesis. There are differences in the intracel- lular signaling between aldosterone synthesis and cortisol synthesis, suggesting that the adipocyte-derived aldosterone synthesizing factors are different from the cortisol synthesiz- ing factors. The adipocyte-derived factors stimulate adrenal cortisol synthesis, and cortisol stimulates adipocyte differen- tiation. In obese patients, the adipocyte-derived factors in- duce cortisol synthesis, which causes obesity and glucose metabolic dysfunction. Recently, it has been revealed that adipocyte-derived miRNAs regulate the gene expression in other tissues [24]. It will be necessary to determine the adi- pocyte-derived factors that cause several types of metabolic dysfunction.
LIST OF ABBREVIATIONS
AC = Adenylate Cyclase
ACTH
= Adrenocorticotropic Hormone
AT1R = Angiotensin Type 1 Receptor
CAMP =
Cyclic Adenine Monophosphate
CREB = cAMP Response Element Binding Protein
CTRP =
Complement-C1q-TNF Related Protein
CYP11B2 = Aldosterone Synthase
DEX = Dexamethasone
HDL
=
High-Density Lipoprotein
IBMX =
1-3-Isobutylmethylxantine
LAMP-1
= Lysosomal-Associated Membrane Protein
LDL = Low-Density Lipoprotein
MC2R
= Melanocortin Type 2 Receptor
RAAS
= Renin-Angiotensin-Aldosterone System
SFRP-1 = Soluble Frizzled Related Protein 1
StAR = Steroid Acute Regulatory Protein
VLDL
= Very low-Density Lipoprotein
Wnt
= Wingless-Type MMTV Integration Site
ZF = Zona Fasciculata
ZG
= Zona Glomerulosa
ZR = Zona Reticularis
CONSENT FOR PUBLICATION
Not applicable.
FUNDING
This work was supported by Japan Society for the Pro- motion of Science (JSPS) KAKENHI Grant Number 16H03252 (for AS).
CONFLICT OF INTEREST
The authors declare no conflict of interest, financial or otherwise.
ACKNOWLEDGEMENTS
Declared none.
REFERENCES
[1] Ehrhart-Bornstein, M .; Lamounier-Zepter, V .; Schraven, A .; Lan- genbach, J .; Willenberg, H.S .; Barthel, A .; Hauner, H .; McCann, S.M .; Scherbaum, W.A .; Bornstein, S.R. Human adipocytes secrete mineralocorticoid-releasing factors. Proc. Natl. Acad. Sci. USA, 2003, 100(24), 14211-14216.
[http://dx.doi.org/10.1073/pnas.2336140100] [PMID: 14614137]
[2] Nagase, M .; Yoshida, S .; Shibata, S .; Nagase, T .; Gotoda, T .; Ando, K .; Fujita, T. Enhanced aldosterone signaling in the early nephropathy of rats with metabolic syndrome: possible contribution of fat-derived factors. J. Am. Soc. Nephrol., 2006, 17(12), 3438- 3446.
[http://dx.doi.org/10.1681/ASN.2006080944] [PMID: 17082236]
[3] Schinner, S .; Willenberg, H.S .; Krause, D .; Schott, M .; Lamounier- Zepter, V .; Krug, A.W .; Ehrhart-Bornstein, M .; Bornstein, S.R .; Scherbaum, W.A. Adipocyte-derived products induce the transcrip- tion of the StAR promoter and stimulate aldosterone and cortisol secretion from adrenocortical cells through the Wnt-signaling pathway. Int. J. Obes., 2007, 31(5), 864-870.
[http://dx.doi.org/10.1038/sj.ijo.0803508] [PMID: 17211444]
[4] Jeon, J.H .; Kim, K.Y .; Kim, J.H .; Baek, A .; Cho, H .; Lee, Y.H .; Kim, J.W .; Kim, D .; Han, S.H .; Lim, J-S .; Kim, K.I .; Yoon, D.Y .; Kim, S-H .; Oh, G.T .; Kim, E .; Yang, Y. A novel adipokine CTRP1 stimulates aldosterone production. FASEB J., 2008, 22(5), 1502- 1511.
[http://dx.doi.org/10.1096/fj.07-9412com] [PMID: 18171693]
[5] Xing, Y .; Rainey, W.E .; Apolzan, J.W .; Francone, O.L .; Harris, R.B.S .; Bollag, W.B. Adrenal cell aldosterone production is stimu- lated by very-low-density lipoprotein (VLDL). Endocrinology, 2012, 153(2), 721-731.
6 Current Molecular Pharmacology, 2020, Vol. 13, No. 1
[http://dx.doi.org/10.1210/en.2011-1752] [PMID: 22186415]
[6] Xing, Y .; Cohen, A .; Rothblat, G .; Sankaranarayanan, S .; Weibel, G .; Royer, L .; Francone, O.L .; Rainey, W.E. Aldosterone produc- tion in human adrenocortical cells is stimulated by high-density lipoprotein 2 (HDL2) through increased expression of aldosterone synthase (CYP11B2). Endocrinology, 2011, 152(3), 751-763. [http://dx.doi.org/10.1210/en.2010-1049] [PMID: 21239432]
[7] Huby, A-C.C .; Antonova, G .; Groenendyk, J .; Gomez-Sanchez, C.E .; Bollag, W.B .; Filosa, J.A .; Belin de Chantemèle, E.J .; De Chantemèle, E.J.B. Adipocyte-derived hormone leptin is a direct regulator of aldosterone secretion, which promotes endothelial dys- function and cardiac fibrosis. Circulation, 2015, 132(22), 2134- 2145. [http://dx.doi.org/10.1161/CIRCULATIONAHA.115.018226] [PMID: 26362633]
[8] Willert, K .; Nusse, R. Wnt proteins. Cold Spring Harb. Perspect. Biol., 2012, 4(9), a007864. [http://dx.doi.org/10.1101/cshperspect.a007864] [PMID: 22952392]
[9] Nusse, R .; Varmus, H.E. Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same re- gion of the host genome. Cell, 1982, 31(1), 99-109. [http://dx.doi.org/10.1016/0092-8674(82)90409-3] [PMID: 6297757]
[10] Wood, M.A .; Acharya, A .; Finco, I .; Swonger, J.M .; Elston, M.J .; Tallquist, M.D .; Hammer, G.D. Fetal adrenal capsular cells serve as progenitor cells for steroidogenic and stromal adrenocortical cell lineages in M. musculus. Development, 2013, 140(22), 4522-4532. [http://dx.doi.org/10.1242/dev.092775] [PMID: 24131628]
[11] King, P .; Paul, A .; Laufer, E. Shh signaling regulates adrenocorti- cal development and identifies progenitors of steroidogenic linea- ges. Proc. Natl. Acad. Sci. USA, 2009, 106(50), 21185-21190. [http://dx.doi.org/10.1073/pnas.0909471106] [PMID: 19955443]
[12] Drelon, C .; Berthon, A .; Sahut-Barnola, I .; Mathieu, M .; Dumontet, T .; Rodriguez, S .; Batisse-Lignier, M .; Tabbal, H .; Tauveron, I .; Lefrançois-Martinez, A.M .; Pointud, J.C .; Gomez-Sanchez, C.E .; Vainio, S .; Shan, J .; Sacco, S .; Schedl, A .; Stratakis, C.A .; Martinez, A .; Val, P. PKA inhibits WNT signalling in adrenal cor- tex zonation and prevents malignant tumour development. Nat. Commun., 2016, 7, 12751. [http://dx.doi.org/10.1038/ncomms12751] [PMID: 27624192]
[13] Gaujoux, S .; Hantel, C .; Launay, P .; Bonnet, S .; Perlemoine, K .; Lefèvre, L .; Guillaud-Bataille, M .; Beuschlein, F .; Tissier, F .; Bertherat, J .; Rizk-Rabin, M .; Ragazzon, B. Silencing mutated ß- catenin inhibits cell proliferation and stimulates apoptosis in the adrenocortical cancer cell line H295R. PLoS One, 2013, 8(2), e55743.
[http://dx.doi.org/10.1371/journal.pone.0055743] [PMID:
23409032]
[14] Schäffler, A .; Buechler, C. CTRP family: linking immunity to metabolism. Trends Endocrinol. Metab., 2012, 23(4), 194-204.
[http://dx.doi.org/10.1016/j.tem.2011.12.003] [PMID: 22261190]
[15] Wang, H .; Wang, R .; Du, D .; Li, F .; Li, Y. Serum levels of Clq/TNF-related protein-1 (CTRP-1) are closely associated with coronary artery disease. BMC Cardiovasc. Disord., 2016, 16, 92. [http://dx.doi.org/10.1186/s12872-016-0266-7] [PMID: 27169633]
[16] Li, Y .; Ozment, T .; Wright, G.L .; Peterson, J.M. Identification of Putative Receptors for the Novel Adipokine CTRP3 Using Ligand- Receptor Capture Technology. PLoS One, 2016, 11(10)e0164593 [http://dx.doi.org/10.1371/journal.pone.0164593] [PMID: 27727322]
[17] Saha, S .; Willenberg, H.S .; Bornstein, S.R .; Graessler, J .; Kop- prasch, S. Diabetic lipoproteins and adrenal aldosterone synthesis — a possible pathophysiological link? Horm. Metab. Res., 2012, 44(3), 239-244. [http://dx.doi.org/10.1055/s-0031-1295459] [PMID: 22147656]
[18] Capponi, A.M. Regulation of cholesterol supply for mineralocorti- coid biosynthesis. Trends Endocrinol. Metab., 2002, 13(3), 118- 121.
[http://dx.doi.org/10.1016/S1043-2760(01)00538-0] [PMID: 11893525]
[19] Huby, A.C .; Otvos, L., Jr; Belin de Chantemèle, E.J. Leptin in- duces hypertension and endothelial dysfunction via aldosterone- dependent mechanisms in obese female mice. Hypertension, 2016, 67(5), 1020-1028.
[http://dx.doi.org/10.1161/HYPERTENSIONAHA.115.06642] [PMID: 26953321]
[20] Hofmann, A .; Peitzsch, M .; Brunssen, C .; Mittag, J .; Jannasch, A .; Frenzel, A .; Brown, N .; Weldon, S.M .; Eisenhofer, G .; Bornstein, S.R .; Morawietz, H. Elevated Steroid Hormone Production in the db/db Mouse Model of Obesity and Type 2 Diabetes. Horm. Me- tab. Res., 2017, 49(1), 43-49. [PMID: 27813053]
[21] Bornstein, S.R .; Uhlmann, K .; Haidan, A .; Ehrhart-Bornstein, M .; Scherbaum, W.A. Evidence for a novel peripheral action of leptin as a metabolic signal to the adrenal gland: leptin inhibits cortisol release directly. Diabetes, 1997, 46(7), 1235-1238. [http://dx.doi.org/10.2337/diab.46.7.1235] [PMID: 9200662]
[22] Walczak, E.M .; Kuick, R .; Finco, I .; Bohin, N .; Hrycaj, S.M .; Wel- lik, D.M .; Hammer, G.D. Wnt signaling inhibits adrenal steroi- dogenesis by cell-autonomous and non-cell-autonomous mecha- nisms. Mol. Endocrinol., 2014, 28(9), 1471-1486. [http://dx.doi.org/10.1210/me.2014-1060] [PMID: 25029241]
[23] Rainey, W.E .; Saner, K .; Schimmer, B.P. Adrenocortical cell lines. Mol. Cell. Endocrinol., 2004, 228(1-2), 23-38. [http://dx.doi.org/10.1016/j.mce.2003.12.020] [PMID: 15541570]
[24] Thomou, T .; Mori, M.A .; Dreyfuss, J.M .; Konishi, M .; Sakaguchi, M .; Wolfrum, C .; Rao, T.N .; Winnay, J.N .; Garcia-Martin, R .; Grinspoon, S.K .; Gorden, P .; Kahn, C.R. Adipose-derived circulat- ing miRNAs regulate gene expression in other tissues. Nature, 2017, 542(7642), 450-455.
[http://dx.doi.org/10.1038/nature21365] [PMID: 28199304]