RESEARCH ARTICLE
Familial Brain Tumour Syndrome Associated with a p53 Germline Deletion of Codon 236
Jann Lübbe 1, Klaus von Ammon 2, Kunihiko Watanabe 1, Monika E. Hegi 1, and Paul Kleihues 1,3
1 Institute of Neuropathology, Department of Pathology and
2 Department of Neurosurgery, University Hospital Zürich, CH-8091 Zürich, Switzerland
3 International Agency for Research on Cancer, F-69372 Lyon, France
This report describes clinical, neuropathological and molecular genetic findings in a Swiss family with four brain tumours in only two generations. The neoplasms observed covered a wide range of biologic behaviour, from a slowly growing lesion already apparent at birth, to anaplastic astrocytoma in a young adult and glioblastomas at the age of less then 10 years. The only non-neural neoplasms in this family were a case of leukemia and an adrenocortical carcinoma. A germline deletion of codon 236 of the p53 tumour suppressor gene was identified as an underlying cause and detected in all affected family members. This mutation has not previously been reported as germline transmission or in sporadic tumours. The unusual accumulation of CNS tumours may be due to a certain organ- specific effect of this particular p53 mutation or it may reflect the specific genetic back-ground of this family.
Introduction
Alterations of the p53 tumour suppressor gene detected in sporadic tumours represent the most common genetic alteration in human neoplasms and occur as somatic point mutations in the four highly conserved regions of the gene (1-4). Evidence for the role of inherited p53 mutations in familial cancer predisposition came from their detection in the germline of patients with the Li-Fraumeni syndrome
Received: 8 November 1994
Corresponding author:
Dr. J. Lübbe, Institute of Neuropathology, Department of Pathology, University Hospital Zürich, CH-8091 Zürich, Switzerland Tel. +41 (1) 255 2107; Fax +41 (1) 255 4402
(LFS) (5, 6). This inherited neoplastic disease was initially described as a familial clustering of soft- tissue or bone sarcomas, breast cancer and an excess of other neoplasms, including leukemia, brain tumours and adrenocortical carcinomas in children and young adults (7). Many, but not all families affected by this autosomal dominant disease carry p53 mutations. This report describes a familial brain tumour syndrome with four central nervous system (CNS) neoplasms in two generations of a Swiss family. The absence of sarcomas and breast tumours puts this pedigree outside the classical LFS. Genetic analyses revealed a p53 germline deletion of codon 236 in all affected family members.
Family and Case Histories
Generation I. The mother / grandmother of the described patients is 68 years old and is well (I B in Fig. 1). Her husband (I A) died of leukemia at the age of 47. He had twelve brothers and sisters. Five have died between the ages of one and 24 years, but none from cancer. Three sisters and five brothers are still alive and well.
Generation II. The couple described as I A and I B had five children: two of them have died of brain tumours (II C and II D), and three are well (II A, II E and II F).
The youngest daughter (II C) was well until the age of 9 1/2, when she began complaining about cephalea and nausea. Clinical examination revealed a temporobasal tumour in the right hemisphere, and a temporal lobectomy was performed. Fractionated radiation (50 Gy) and cytostatic therapy were carried out but three months after surgery, a tumour recurrence became apparent and the patient died at the age of 10 years.
Except for tonsillectomy, the elder sister (II D) was well until the age of 22, when she experienced visual disturbances and weakness of the left arm, followed by episodes of unsteady gait, blurred speech and lack of concentration. Two months later, she had a generalized epileptic seizure and was admitted to the hospital where she presented with a Foster-Kennedy syndrome on the right side, central facial paresis on the left side, and left-sided hemiparesis. CT showed a
5
3
T
A 47 yr LKM
B
68 yr
II
T
T
A
B
C
D 27 yr AA ACC
E
F 38 yr
32 yr
10 yr GBM
34 yr
T
T
A
C
D
E
5 yr GBM
B 9 yr BT
4 yr
4 yr
8 yr
very large cystic mass in the frontoparietal right hemisphere. The tumor was surgically removed and the patient underwent fractionated radiation therapy (total dose, 50 gy) postoperatively. Four years later, an androgen producing adrenocortical carcinoma was diagnosed and surgically removed. One year later, the patient had a grand-mal seizure and a CT scan revealed a large butterfly-shaped glioma recurrence. The patient died 2 1/2 months later at the age of 27 years.
Generation III. One female member of generation (II A) had three sons (III A, B, C). At the age of 4 1/2 years, patient III A was admitted to the hospital in a stuporous state, with déviation conjugée to the left, and clonic seizures of the left leg. CT and MRI scans showed an ill-defined occipital lesion in the right hemisphere that was surgically removed (Fig. 2). Three months later the patient again developed raised intracranial pressure. MRI scans suggested tumour recurrence. The tumour was surgically removed and the patient died three months later. Patient III B developed signs of hydrocephalus shortly after birth. CT scans showed an irregularly
shaped central mass and a marked hydrocephalus. A ventriculo-atrial shunt was inserted at the age of 10 months. Repeated CT controls suggested the presence of a slowly growing tumour with signs of calcification, most likely a pilocytic astrocytoma (WHO Grade I) or oligodendroglioma (WHO Grade II). The last MRI was performed at the age of 9 years in 1994 and there was no unambiguous evidence of tumour growth (Fig. 2). The youngest of the three brothers (III C) and two cousins (III D and III E) are healthy.
Materials and Methods
Immunohistochemistry. The sections for the immunohistochemical stainings for GFAP and P53 protein were deparaffinized in xylene and rehydrated in graded ethanol. The endogeneous peroxidase was blocked by 3% H202 in absolute methanol for 20 minutes. The sections were preincubated with normal swine serum (diluted 1:5 in PBS, Dako) or normal rabbit serum (diluted 1:10 in PBS, Dako) for GFAP and P53, respectively, followed by incubation with the primary antibody for 60 minutes (GFAP
R
L
polyclonal antibody, diluted 1:300 in PBS, Dako; P53 monoclonal antibody, diluted 1:300 in PBS, Cambridge Research Biochemicals). After rinsing in PBS, sections were incubated with swine anti-rabbit, biotinylated (GFAP) or rabbit anti-mouse, biotinylated (P53) for 30 min (Dako). This was followed by a 30 minute incubation with the avidin- biotin complex (Dako) and finally the reaction was revealed with diaminobenzidine. Immunohisto- chemical stains for MIB-1 were performed according to the microwave oven heating method. De- paraffinized slides were placed in 10 mM citrate buffer (pH 6.0) and incubated in a 750 W microwave oven for 3 cycles of 5 minutes each. The slides were then allowed to cool for 20 min, rinsed in distilled water twice, and equilibrated in PBS for 5 min. Sections were then stained with monoclonal antibody MIB-1 (Dianova, Hamburg, Germany; dilution: 1:10).
In all MIB-1 and P53 immunoreactive specimens, the staining was quantified at 400 x magnification on 3-5 visual fields each, using a square graticule. More than one thousand nuclei were counted in each specimen.
Extraction of DNA. DNA was extracted from white blood cells, fresh frozen biopsy specimens, or archival paraffin embedded tissue. Blood could be obtained from I B, II A, II B, II E, II F, III A, III B, and III C. White blood cells were digested with proteinase K in equal volumes of phosphate buffered saline
(PBS) and 2x lysis buffer (Applied Biosystems) for three hours at 50℃. DNA was precipitated in ethanol after phenol-chloroform extraction, and diluted with H2O to a final concentration of 100 ng/ul. From patient III A, tumour biopsies were obtained directly from surgery, shock frozen and stored at -80℃ until further use. From patients II C and II D, only archival paraffin embedded tissue was available. About four 8 um thin and 1cm2 large sections were used for extraction. Under microscopic control, the neoplastic parts of the sections were scraped off with a razor blade and directly shifted into 1.5 ml reaction tubes. The same was done with surrounding normal tissue, if present. The material was incubated with 100 ul DNA extraction buffer (50 mM Tris pH 8.5, 1 mM EDTA pH 8.0 and 0.5% Tween 20), heated to 95℃ for 30 min, and spun down in a benchtop centrifuge for 30 min at 13000 g, while cooling down to 4℃. A solid paraffin cap formed during the procedure which could easily be removed. The solution was digested with proteinase K at 37℃ overnight. The product was then heated at 95°℃ for ten minutes to inactivate the proteinase K.
Polymerase chain reaction (PCR). PCR was carried out with 70 to 150 ng of genomic DNA, 2.0 pmol of each primer, 50 uM deoxynucleotide triphosphates, 0.8 uCi of [@-32P] dCTP (Amersham, specific activity 3000 Ci/mmol), 0.8 ul PCR-buffer II (Perkin Elmer Cetus), 0.5 units Taq polymerase (Perkin Elmer Cetus) and 0.8 to 1.5 mM MgCl2 in a final volume of
A
B
C
D
8 ul. After addition of 10 ul mineral oil (Sigma), the samples were subjected to 35 cycles of denaturation (95°℃ for 60 s), annealing (60°℃ for 60 s) and extension (72℃ for 70 s) using an automated DNA Thermal Cycler (Perkin Elmer Cetus). The primers for exons 5 to 8 were designed from intron sequences (8) as described earlier (9). The following primers were used for exon 7: 5’ ACTGGCCTCATCTTGGGCCTGT 3’, and 5’ CGGTGAACGGTGGGACGTGT 3’.
Single-strand conformation analysis (PCR-SSCA). Screening of the samples for detection of mutations in the p53 gene was performed basically according to the method described by Orita et al. (10). Two ul of the PCR product were mixed with 2 ul 0.1 M NaOH and 9 ul of sequencing stop solution (USB). Samples were heated at 95℃ for 10 min and immediately loaded onto a 6% polyacrylamide nondenaturating gel containing 10% glycerol. Gels were runt at 7 W for 13-15 hours at room temperature. For autora- diography, dried gels were exposed for 12-36 hours with an intensifying screen at -80℃ and the banding patterns were analyzed for abnormal shifts. Negative controls, with confirmed normal base sequence in the respective exon, were run on each gel. All samples were subjected to at least two PCR-SSCAs.
Direct sequencing of PCR products. The amplified product of a 40 ul PCR (not 32P-labeled) was loaded on to a 6% polyacrylamide gel, run at 160 Volts for 20 min, stained with ethidium bromide and visualized under UV light. The specific bands were cut out, eluted in 0.5 M ammonium acetate and 1 mM EDTA at 37℃ overnight, and precipitated with ethanol. DNA was pelleted, dried, and dissolved in 13 ul H2O. Sanger dideoxynucleotide sequencing was performed using the sequencing kit from USB. Four ul dissolved DNA and 7.5 pmol primer were mixed with 2 ul 5x reaction buffer and 1 ul DMSO in a final volume of 10 ul, heated at 95℃ for 5 min, and shock frozen in liquid nitrogen. An aliquot consisting of 1.5 uCi [@-32P]-dCTP, 20 mM dithiothreitol and 2.5 u of Sequenase version 2.0 (USB) in a total volume of 5 ul was added and aliquots of the mix immediately brought to reaction in a microwell plate (Nunc) with the four termination mixtures (USB) for 10 min at 37°C. The reaction product was mixed with 4 ul stop solution, heated at 90℃ for 2 min and immediately loaded onto a 6% polyacrylamide 7 M urea sequencing gel (Gibco) preheated to 50℃. The gel was run at 1700 Volts for 2 h. Dried gels were subjected to autoradiography.
| Family member1 | Age2 | Tumour | P53 Accumulation % cells | p53 Gene mutations | |
|---|---|---|---|---|---|
| Tumour | Normal tissue | ||||
| IB | 68 | wt/wt | |||
| II A | 32 | A236/wt | |||
| II B | 37 | wt/wt | |||
| II C | 103 | Glioblastoma | 44 | A236/del5 | A236/wt |
| II D | 273 | Anaplastic astrocytoma | 13 | A236/del5 | A236/wt |
| Adrenocortical carc. | 0 | A236/wt mut cod. 2736/del5 | |||
| II E | 34 | wt/wt | |||
| 11 F | 38 | wt/wt | |||
| III A | 53 | Glioblastoma4 | 13 | A236/del5 | A236/wt |
| II B | 9 | Brain tumour | nd | nd | A236/wt |
| III C | 4 | wt/wt | |||
1See pedigree in Fig. 1; 2Current age; 3Age at death; 4Expression of mRNA containing A236 (determined only in this tumour); 5Deletion of wild-type allele based on sequence analysis; 6Ref. 14
Abbreviations: nd, not determined; A236, deletion of codon 236; wt, wild-type allele
Selective oligonucleotide hybridization. cDNA was prepared from the tumour of patient III A using the RNA isolation method described by Chomczynski and Sacchi (11) and performing reverse transcription with oligo-dT or random primers using a RNA-PCR KIT (Perkin Elmer). A 505 base pair (bp) fragment, containing bp 740 to 1246 of the p53 cDNA was amplified by PCR using nested primers. Ten ul of the PCR-reaction were run on a 1% agarose gel, which was blotted onto a N-bond plus membrane (Amersham) under alkaline conditions. Synthetic 19-mer oligonucleotides, centered on codon 236 or on the deletion of codon 236 (bp 841-843) were used as probes for the normal sequence or the deletion mutant, respectively. The oligonucleotides were endlabeled with [y-32p]ATP (Amersham) and T4 polynucleotide kinase (Boehringer Mannheim) and purified on Nick Columns (Pharmacia) prior to use. The filters were hybridized and washed mainly according to the dot-blot method of Verlaan-de Vries et al. (12). For higher stringency the hybridization solution contained 30% formamide and 0.5% SDS. The blots were washed two degrees below Tm of the respective oligonucleotide. No hybridization of the oligonucleotide, lacking codon 236 to a PCR product from normal p53 cDNA was observed.
Results
Surgical pathology and immunostainings. Brain tumour, patient II C: Histopathological examination revealed a highly anaplastic, loosely textured neoplasm with marked mitotic activity and focal necrosis. Tumour cells were round or polygonal
shaped and showed a tendency to cluster around vessels. Immunohistochemically, there was a marked expression of GFAP and a nuclear accumulation of the P53 protein (Fig. 3C) in 44% of tumour cells. The growth fraction (percent of MIB-1 stained nuclei) amounted to 9.8%. According to the criteria of the World Health Organization (13) the neoplasm was diagnosed as glioblastoma multiforme (WHO Grade IV).
Brain tumour, patient II D: In most areas, the tumour displayed the typical features of a fibrillary astrocytoma with low cellularity and numerous microcysts. However, there were foci with an admixture of neoplastic gemistocytic astrocytes, increased cellularity, occasional giant cells and occasional small foci of necrosis. GFAP expression was moderate. A significant fraction of tumour cell nuclei (13%) showed an immunohistochemically detectable accumulation of the P53 protein (Fig. 3A). Mitoses were rare but immunostaining for MIB-1/Ki-67 showed a growth fraction of 14.5%. On the basis of these criteria, the tumour was classified as anaplastic astrocytoma (WHO Grade III).
Adrenocortical carcinoma, patient II D: The biopsy exhibited a highly polymorphic tumour of characteristic endocrine structure (Fig. 3B). It consisted of small cells with round nuclei and in addition showed a marked pleomorphism including bizarre cells and multinucleated tumour giant cells. There were mitotic figures including abnormal forms. Furthermore, there appeared to be a focal capsular infiltration as well as infiltration of
IB HIA IIE IIIA IIIB IIIC wt
several veins inside the tumour. No immuno- histochemically detectable P53 expression was observed.
Brain tumour, patient III A: Histopathologically, the biopsy showed the features of a highly anaplastic tumour of astrocytic origin (Fig. 3D). Tumour cells varied considerably in shape and size and there was a marked mitotic activity, with a growth fraction of 11.7%. A small number of tumour cell nuclei (6%) showed an immunohistochemically detectable accumulation of the P53 protein. The second biopsy revealed similar histopathological features (growth fraction, 17.5%; P53 labeling index, 13%). The diagnosis of glioblastoma multiforme was made, based on the high degree of anaplasia and presence of vascular proliferations and focal necrosis.
p53 Mutations. SSCA of white blood cell DNA was carried out on a total of 8 family members. Of these, three individuals (II A, III A, III B) showed an altered migration pattern, indicative for the presence of a mutation in p53 exon 7 (Fig. 4). In these samples, sequencing analysis identified a deletion. of codon 236 in exon 7 of the p53 tumour suppressor gene (Fig. 5, 6). The sequence ladder of DNA from white blood cells suggested the presence of both, the deletion mutant and the wild-type allele, whereas glioma-derived DNA sequences did not show wild- type bands, indicating loss of heterozygosity in these tumours (Fig. 5, 6). In contrast, the sequencing pattern adjacent to codon 236 of the adrenocortical carcinoma of patient II D suggested the presence of both, the mutant and the wild-type allele. However,
ACGT ACGT
3’
3’ 3’
T
G
C
A
1
À
C
A 236 A
*
5’
5’ 5’
mut / wt
wt / wt
this tumour harbored an additional p53 mutation (C→T in codon 273, exon 8) as previously documented (14). The germline deletion of codon 236 was not present in white blood cell DNA from four healthy pedigree members (I B, II E, II F, III C) and from the husband (II B) of II A. The deletion mutation was also confirmed in the cDNA isolated from the tumour of patient III A using selective oligonucleotide hybridization. Expression of the deletion mutant protein was present in all the brain tumours as indicated by immunohistochemical staining and the apparent loss of the wild-type p53 allele. In addition, expression of the mutant mRNA was determined in the tumour from patient III A. For a synopsis of the genetic analyses see Figs. 4 to 6 and Table 1.
Discussion
The association of a p53 germline mutation with a familial clustering of brain tumours as reported here is exceptional: (i) four members in only two generations developed a brain tumour, (ii) only two non-neural neoplasms were observed (leukemia, adrenocortical carcinoma), and (iii) the underlying mutation, i.e. deletion of codon 236 has not previously been reported. The types of CNS tumours observed span a wide range, from a benign, slowly growing inborn lesion to highly malignant glioblastomas. To date, 68 unrelated pedigrees or individuals with p53 germline mutations have been described (15 and T. Soussi, personal commun- ication; Kleihues, manuscript in preparation). For
ACGT ACGT ACGT ACGT
3’
A 236
OCH
5’
mut / - IIIA
mut / wt HIA
mut / wt IIIB
wt / wt IIIC
half of them, at least one individual has been diagnosed with a brain tumour. Nine of the pedigrees show more than one brain tumour case (5, 6, 16-20). In 6 families two individuals developed a brain tumour and three families have three members with a brain tumour. Recently, Kyritsis and coworkers (18) uncovered an exceptionally high frequency of germline mutations in patients affected with multifocal glioma, glioma and secondary malignancies, glioma and a family history of cancer, or all three risk factors combined. However, in none of the published pedigrees with p53 germline mutations are brain tumours the predominant neoplasm.
The deletion of codon 236 in exon 7 of the p53 gene leads to the loss of tyrosine in the gene product which is located in the second loop of the P53 protein that binds to DNA within the minor groove (21). This codon has been reported to be affected by point mutations in a variety of sporadic tumours, and in one case was part of a larger deletion (22). The predominant mutational type in both somatic and germline p53 mutations are missense mutations. Deletions are less frequent and usually change the genetic reading frame, producing truncated proteins (2, 23). However, the deletion mutation detected in this study is in frame, i.e. an untruncated gene product is likely to be synthesized. Accordingly, reverse transcription and PCR of the mRNA derived from the glioblastoma from Patient III A yielded mutant cDNA. Sequence analysis of the p53 gene in this tumour suggested loss of the wild-type allele,
hence indicating that the P53 accumulated in the tumour cell nuclei is the product of the mutant allele.
The unusual association of this p53 germline mutation with a familial brain tumour syndrome allows some speculations on possible organ-specific properties of this novel deletion mutant. There is evidence that not all alterations of the p53 gene lead to abolished function but instead may confer a mutation dependent gain of function and thereby provide a growth advantage to tumour cells (24). These in vitro assessed functional properties encompass the ability of mutant P53 proteins to transactivate reporter genes, to bind to cellular or viral proto-oncogenes or to increase tumorigenic potential of cells lacking endogenous p53 (summarized in 24, 25). However, tissue-specific properties of distinct p53 mutations have not been described, and the mutational hot spot, codon 249 observed in certain liver tumours is thought to reflect the involvement of a specific environmental carcinogen, i.e., aflatoxin B1 (26, 27). Furthermore, p53 mutations in brain tumours (9, 28) or in the germline of kindreds with brain tumours have not been reported to display an organ specific mutation clustering at certain sites of the gene. Monitoring p53 knockout mice of different genetic background indicated that loss of function enforces a prior strain specific tumour predisposition reflected in both the rate and the spectrum of tumours developing (29). Furthermore, no mouse model exists for a potential gain of function p53 mutant that exhibits organ
specific tumorigenic properties (30). However, tissue specific expression of a p53 transgene mediated by intron sequences has been reported (31).
In all brain tumour-derived DNA of the presented kindred, the sequencing patterns of exon 7 indicated the loss of the wild-type allele in contrast to the white blood cells in which both the wild-type and mutant allele were present (Figs. 5, 6). Loss of the wild-type allele has been frequently observed in tumours that arose in carriers of p53 germline mutation (32) as well as in sporadic tumours (33-35) and has been associated with tumour progression (36). This is consistent with the concept of tumour suppressor gene function (37). The adrenocortical carcinoma of patient II D contained two mutations, the deletion of codon 236 and a point mutation in exon 8, (C→T, Arg → Cys, codon 273) as reported earlier (14). With paraffin-embedded tissue as the only source of DNA, we could not determine whether both mutations were located on the same allele. Sequence analysis at codon 273 (exon 8) indicated loss of the second allele (14), while sequence analysis adjacent to codon 236 (exon 7) exhibited both, the wild-type allele and the allele containing the deletion mutation. This discrepancy could be due to tumour heterogeneity or contamination with non-neoplastic tissue. Zhang et al. (38) reported the frequent occurrence of tandem or even multiple mutations in the p53 gene of pontine gliomas of juvenile onset. Otherwise, double mutations are rare except for nonmelanoma skin tumours, which in 45% carry a second mutation, usually without loss of heterozygosity (39). It was concluded that UV-light exposure increases the probability of a second mutational event.
Astrocytic brain tumours, WHO grade II to IV exhibit an apparent grade independent frequency of p53 mutations (9, 28) suggesting that this genetic alteration represents a fairly early event during carcinogenesis. However, other studies found this alteration prevalent in high-grade gliomas, and emphasized its importance in the progression from low-grade tumors (40-42). The early onset of the astrocytic brain tumors observed in this family in association with a p53 germline mutation represents another important indication for the significance of p53 alterations early in carcinogenesis of this tumour type.
In conclusion, the family described in this report offers an exceptional insight into the wide range of adverse biological effects of an unusual p53 germline mutation. The results obtained led to an effective genetic counseling and a probable termination of the disease after the third generation.
Acknowledgments
This research project was supported by the Swiss National Foundation.
References
1. Hollstein M, Sidransky D, Vogelstein B, Harris CC (1991) p53 mutations in human cancers. Science 253: 49-53
2. Caron de Fromentel C, Soussi T (1992) TP53 tumor suppressor gene: a model for investigating human mutagenesis. Genes Chromos Cancer 4: 1-15
3. Soussi T, Caron de Fromentel C, May P (1990) Structural aspects of the p53 protein in relation to gene evolution. Oncogene 5: 945-952
4. Greenblatt MS, Bennett WP, Hollstein M, Harris CC (1994) Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res 54: 4855-4878
5. Malkin D, Li FP, Strong LC, Fraumeni JJ, Nelson CE, Kim DH, Kassel J, Gryka MA, Bischoff FZ, Tainsky MA, Friend SH(1990) Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 250: 1233-1238
6. Srivastava S, Zou Z, Pirollo K, Blattner W, Chang EH (1990) Germ-line transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome. Nature 348: 747-749
7. Li FP, Fraumeni JP (1969) Soft-tissue sarcomas, breast cancer and other neoplasms. Ann Int Med 71: 747-752
8. Sakai E, Tsuchida N (1992) Most human squamous cell carcinomas in the oral cavity contain mutated p53 tumor- suppressor genes. Oncogene 7: 927-933
9. Ohgaki H, Eibl RH, Schwab M, Reichel MB, Mariani L, Gehring M, Petersen I, Höll T, Wiestler OD, Kleihues P (1993) Mutations of the p53 tumour suppressor gene in neoplasms of the human nervous system. Mol Carcinog 8:74-80
10. Orita M, Suzuki Y, Sekiya T, Hayashi K (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5: 874-879
11. Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol- chloroform extraction. Analyt Biochem 162: 156-159
12. Verlaan-deVries M, Bogaard ME, van den Elst H, van Boom HJ, van der Eb AJ, Bos JL (1986) A dot-blot screening procedure for mutated ras oncogenes using oligodeoxynucleotides. Gene 50: 313-320
13. Kleihues P, Burger PC, Scheithauer BW (1993) Histological Typing of Tumours of the Central Nervous System, World Health Organization, International Histological Classification of Tumours, Springer-Verlag: Berlin, Heidelberg
14. Ohgaki H, Kleihues P, Heitz PU (1993) p53 mutations in sporadic adrenocortical tumors. Int J Cancer 54: 408-410
15. Cariello NF, Cui L, Beroud C, Soussi T (1994) Database and software for the analysis of mutations in the human p53 gene. Cancer Res 54: 4454-4460
16. Malkin D, Friend SH (1993) Correction: a Li-Fraumeni syndrome p53 mutation (letter). Science 259: 878
17. Metzger AK, Sheffield VC, Duyk G, Daneshvar L, Edwards MSB, Cogen PH (1991) Identification of a germ-line mutation in the p53 gene in a patient with an intracranial ependymoma. Proc Natl Acad Sci USA 88: 7825-7829
18. Kyritsis AP, Bondy ML, Xiao M, Berman EL, Cunningham JE, Lee PS, Levin VA, Saya H (1994) Germline p53 gene mutations in subsets of glioma patients. JNC/ 86: 344-348
19. Brugieres L, Gardes M, Moutou C, Chompret A, Meresse V, Martin A, Poisson N, Flamant F, Bonaiti PC, Lemerle J, et al (1993) Screening for germ line p53 mutations in children with malignant tumors and a family history of cancer. Cancer Res 53: 452-455
20. Scott RJ, Krummenacher F, Mary JL, Weber W, Spycher M, Müller H (1993) Vererbbare p53-Mutation bei einem Patienten mit Mehrfachtumoren: Bedeutung für genetische Beratung. Schweiz Med Wochenschr 123: 1287-1292
21. Cho Y, Gorina S, Jeffrey PD, Pavletich NP (1994) Crystal structure of p53 tumor suppressor-DNA complex: understanding tumorigenic mutations. Science 265: 346- 355
22. Hollstein M, Rice K, Greenblatt MS, Soussi T, Fuchs R, Sorlie T, Hovig E, Smith-Sorensen B, Montesano R, Harris CC (1994) Database of p53 gene somatic mutations in human tumors and cell lines. Nucleic Acids Res (Suppl) 22: (in press)
23. Frebourg T, Friend SH (1992) Cancer risks from germline p53 mutations. J Clin Invest 90: 1637-1641
24. Dittmer D, Pati S, Zambetti G, Chu S, Teresky AK, Moore M, Finlay C, Levine AJ (1993) Gain of function mutations in p53. Nature Genetics 4: 42-45.
25. Zambetti GP, Levine AJ (1993) A comparison of the biological activities of wild-type and mutant p53. FASEB 7: 855-865
26. Hsu IC, Metcalf RA, Sun T, Welsh JA, Wang NA, Harris CC (1991) Mutational hotspot in the p53 gene in human hepatocellular carcinomas. Nature 350: 427-428
27. Bressac B, Kew M, Wands J, Ozturk M (1991) Selective G to T mutations of p53 gene in hepatocellular carcinoma from southern Africa. Nature 350: 429-431
28. Louis DN (1994) The p53 gene and protein in human brain tumors. J Neuropath Exp Neurol 53: 11-21
29. Harvey M, McArthur MJ, Montgomery CA, Bradley A, Donehower LA (1993) Genetic background alters spectrum of tumors that develop in p53-deficient mice. FASEB 7: 938-943
30. Lavigeur A, Maltby V, Mock D, Rossant J, Pawson T, Bernstein A (1989) High incidence of lung, bone, and lymphoid tumors in transgenic mice overexpressing mutant alleles of the p53 oncogene. Mol Cell Biol 9: 3982-3991
31. Lozano G, Levine AJ (1991) Tissue-specific expression of p53 in transgenic mice is regulated by intron sequences. Mol Carcinogen 4: 3-9
32. Srivastava S, Tong YA, Devadas K, Zou ZQ, Sykes VW, Chen Y, Blattner WA, Pirollo K, Chang EH (1992) Detection of both mutant and wild-type p53 protein in normal skin fibroblasts and demonstration of a shared ‘second hit’ on p53 in diverse tumors from a cancer-prone family with Li-Fraumeni syndrome. Oncogene 7: 987-991
33. Iggo R, Gatter K, Bartek J, Lane D, Harris AL (1990) Increased expression of mutant forms of p53 oncogene in primary lung cancer. Lancet 335: 675-679
34. Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R, Cleary K, Bigner SH, Davidson N, Baylin S, Devilee P, Glover T, Collins FS, Weston A, Modali R, Harris CC, Vogelstein B (1989) Mutations in the p53 gene occur in diverse human tumor types. Nature 342: 705-708
35. Takahashi T, Nau MM, Chiba I, Birrer MJ, Rosenberg RK, Vinocour M, Levitt M, Pass H, Gazdar AF, Minna JD (1989) p53: a frequent target for genetic abnormalities in lung cancer. Science 246: 491-494.
36. Fearon ER (1992) Genetic alterations underlying colorectal tumorigenesis. Canc Surv 12: 119-136.
37. Knudson AG (1971) Mutation and cancer: statistical study of retinoblastomas. Proc Natl Acad Sci USA 68: 820-823.
38. Zhang S, Feng X, Koga H, Ichikawa T, Abe S, Kumanishi T (1993) p53 gene mutations in pontine gliomas of juvenile onset. Biochem Biophys Res Comm 196: 851-857
39. Ziegler A, Leffell DJ, Kunala S, Sharma HW, Gailani M, Simon JA, Halperin AJ, Baden HP, Shapiro PE, Bale AE, Brash DE (1993) Mutation hotspots due to sunlight in the p53 gene of nonmelanoma skin cancer. Proc Natl Acad Sci USA 90: 4216-4220
40. Fults D, Brockmeyer D, Tullous MW, Pedone CA, Cawthon RM (1992) p53 mutations and loss of heterozygosity on chromosome 17 and 10 during human astrocytoma progression. Cancer Res 52: 674-679
41. Hayashi Y, Yamashita J, Yamaguchi K (1991) Timing and role of p53 gene mutation in the recurrence of glioma. Biochem Biophys Res Commun 180: 1145-1150
42. Sidransky D, Mikkelsen T, Schwechheimer K, Rosenblum ML, Cavenee W, Vogelstein B (1992) Clonal expansion of p53 mutant cells is associated with brain tumour progression. Nature 355: 846-847