Insulin-Like Growth Factors (IGFs) and Their Receptors in Adrenal Tumors: High IGF-II Expression in Functional Adrenocortical Carcinomas*
VESA ILVESMÄKI, ARVI I. KAHRI, PÄIVI J. MIETTINEN, AND RAIMO VOUTILAINEN
Departments of Pathology (V.I., A.I.K., P.J.M., R.V.) and Pediatrics (R.V.), University of Helsinki, SF-00290 Helsinki, Finland
ABSTRACT
An increasing body of evidence suggests that insulin-like growth factors (IGFs) are important in the development of some tumors. In the present study, we investigated the gene expression of IGF-I, IGF- II, and their receptors in different adrenal tumors and hyperplasias. Four adrenocortical carcinomas, 15 adenomas, 4 pheochromocytomas, 5 nodular hyperplasias, and hyperplastic adrenals from 2 patients with pituitary Cushing’s disease were analyzed and compared to normal adrenals. Northern blots, dot blots, and reverse transcription polym- erase chain reaction analyses were used for mRNA detection, and immunohistochemistry was used for IGF-II peptide localization. The IGF-I mRNA content was low in normal, hyperplastic, and neoplastic adrenals. IGF-II mRNA levels were more than 10-fold higher in hor- monally active adrenocortical carcinomas than in normal adult adre- nals, and increased IGF-II-like immunoreactivity was detectable in
these carcinomas. A moderate elevation of the IGF-II mRNA content was also noted in one nonfunctioning carcinoma. The IGF-II mRNA content was high in pheochromocytomas, as reported previously. Fur- thermore, Cushing’s and Conn’s adenomas expressed IGF-II mRNA levels similar to those in the normal adrenal. In nodular adrenocortical hyperplasia, we found variable IGF-II mRNA content (40-400% of normal adrenal expression). All of the normal adrenal and tumor tissues studied contained both the type I and type II IGF receptor mRNAs. The findings in the present study show that both IGF-I and IGF-II and their receptor mRNAs are expressed in various adrenocortical tumors. Moreover, the high IGF-II expression in functional adrenocor- tical carcinomas suggests that the IGFs may be involved in the auto/ paracrine regulation of certain adrenocortical tumors. (J Clin Endocri- nol Metab 77: 852-858, 1993)
A BERRATIONS in peptide growth factor-signaling path- ways in tumor cells may function via autocrine mech- anisms and explain part of the autonomous growth of tumors (1). It has also been speculated that autocrine mechanisms may be involved in cell transformation and tumorigenesis themselves (2). Growth factors may contribute to the later stages of tumor progression after a transformation event has taken place (3). There is much evidence of genetic alterations affecting growth factors or their receptors in human malig- nancies (4). However, direct evidence that autocrinicity is involved in tumor evolution in vivo is lacking.
Insulin-like growth factor-I (IGF-I) and IGF-II are poly- peptides that are structurally related to proinsulin. The IGFs have important roles in normal growth and development. IGF-I mediates the anabolic effects of GH in postnatal life. IGF-II has been postulated to be a growth regulator during fetal development and in the central nervous system, but it has no defined function in the adult (5). The IGFs are synthesized in multiple tissues, and their actions may be auto/paracrine or endocrine. Distinct receptors for IGF-I and IGF-II are well characterized. The type I IGF receptor (IGF-I
Received December 22, 1992. Accepted April 13, 1993.
Address all correspondence and requests for reprints to: Dr. Vesa Ilvesmäki, Department of Pathology, P.O. Box 21 (Haartmaninkatu 3), University of Helsinki, SF-00014 Helsinki, Finland.
* This work was supported by the Academy of Finland, the Cancer Society of Finland, the Sigrid Juselius Foundation, the Nordisk Insulin Foundation, the Ida Montin Foundation, and the Jalmari and Rauha Ahokas Foundation.
receptor) is a transmembrane heterotetramer structurally very similar to the insulin receptor with an intracellular tyrosine kinase domain (6). The type II IGF receptor (IGF-II receptor) is a single polypeptide without intrinsic kinase activity, and it is also the mannose-6-phosphate receptor, which is in- volved in targeting of the lysosomal enzymes (7). Studies with receptor-blocking antibodies suggest that most of the known effects of both IGF-I and IGF-II are mediated via IGF-I receptor instead of IGF-II receptor (5).
The IGFs may contribute to neoplastic cell proliferation. Both IGFs have been shown to be mitogenic for various types of tumor cells. Elevated levels of IGF-II, and less commonly of IGF-I, have been observed in different tumors (5, 8). High IGF-II mRNA levels have been reported in Wilms’ tumor, rhabdomyosarcoma, hepatoblastoma, liposarcoma, colon carcinoma, pheochromocytoma, some neuroblastomas, leiomyomas, and leiomyosarcomas (8). IGF overexpression is thought not to act as a transforming factor, but it may contribute to tumor cell proliferation. This view is supported by the findings that blockade of the IGF-I receptor with receptor antibody inhibits autonomous cell growth in an IGF-I-producing small cell lung carcinoma cell line (9) and in an IGF-II-producing neuroblastoma cell line (10).
The IGF-II gene is highly expressed in actively growing human fetal adrenal cortex, but only relatively weak expres- sion is seen in normal adult adrenals (11). As ACTH has a stimulatory effect on IGF-II gene expression in human fetal adrenocortical cells (11, 12), it is possible that ACTH-induced
adrenal growth is mediated via IGF-II. In the present study we have investigated the expression of IGFs and their recep- tors in adrenal tumors and hyperplasias to further clarify the significance of the IGF system in the auto/paracrine regula- tion of normal and neoplastic adrenal growth.
Materials and Methods
Tissue samples
Tumor specimens were obtained from the Department of Surgery, Helsinki University Central Hospital, and were send to the Department of Pathology aseptically. At the time of surgery, the pathologist dissected the tumor and provided a sample of fresh nonnecrotic tumor tissue. The histological diagnosis was confirmed by the pathologist. The tumor specimens were frozen in liquid nitrogen within 1 h after surgery or were placed in culture medium for cell culture purposes. The deep- frozen specimens were stored at -70 C until further use. The specimens for immunohistochemistry were fixed in formalin and embedded in paraffin. The tumors studied were Cushing’s carcinoma (n = 3), non- functional adrenocortical carcinoma (n = 1), Cushing’s adenoma (n = 7), Conn’s adenoma (n = 5), nonfunctional adrenocortical adenoma (n = 3), myelolipoma (n = 1), and pheochromocytoma (n = 4). In addition, two cases of bilateral adrenal hyperplasias associated with pituitary Cushing’s disease and five cases of nodular hyperplasia (with- out steroid overproduction) were examined. We also investigated the adjacent adrenals from tumor patients, if available. Normal adrenal glands were obtained from renal carcinoma patients who underwent nephrectomy due to their renal tumors. Human fetal tissues were obtained from legal second trimester abortions, as described previously (13).
Cell cultures
Primary cell cultures were prepared from some tumor specimens and normal adrenals, as previously described (13). The tissues were first minced with scissors to approximately 1-mm3 pieces. Cells were then dispersed with 0.1% collagenase-dispase (Boehringer Mannheim, Mann- heim, Germany). Approximately 3 x 105 cells were plated on six-well plastic culture dishes (Nunc, Roskilde, Denmark) and grown to subcon- fluency (7-8 days) before incubations were started with synthetic ACTH- (1-24) (S-Cortrophin, Organon, Oss, The Netherlands) or dibutyryl cAMP (Sigma Chemical Co., St. Louis, MO). Incubations were continued for 2 days before cell harvesting.
RNA preparation and analysis
Total cellular RNA was isolated from frozen tissues by the guanidi- nium thiocyanate method (14). Cytoplasmic RNA was isolated from cultured cells, and Northern blots or dot blots were prepared as described previously (13), using Hybond N filters (Amersham International, Aylesbury, Buckinghamshire, United Kingdom). All of the studied tumor specimens were analyzed with both Northern and dot blotting. Similar IGF-II results were obtained with both of these methods, whereas IGF- I signals could be detected only by dot blotting (Northern blots remained under the detection level). All of the studied tumor specimens were blotted onto 2 similar filters with a 96-well Minifold I apparatus (Schleicher and Schuell, Dassel, Germany). The filters were hybridized with 32P-labeled cDNA probes for IGF-I (15) and IGF-II (15), human y- actin (16), human P450c17 (17), and mouse ribosomal 28S subunit (18). We also constructed a riboprobe for IGF-I. A 403-basepair PstI/BamHI fragment of human IGF-I cDNA was subcloned to pGEM 4z and labeled by in vitro transcription using T7 RNA polymerase and [32PJUTP (800 Ci/mmol). The cDNA probes were labeled by random priming (Oligo- labelling Kit, Pharmacia, Uppsala, Sweden) to specific activities between 0.5-1.0 × 109 cpm/ug using [32P]deoxy-CTP (6000 Ci/mmol). Hybridi- zation and washing of the filters were performed as described previously (13), except that the washing temperature was elevated to 50 C. IGF-I riboprobe hybridization and washing temperatures were 65 C. Filters
were autoradiographed at -70 C with Trimax T16 intensifying screens (3 M, Ferrania, Italy) and Hyperfilm-MP films (Amersham). The inten- sities of the autoradiographic signals were quantified by densitometric scanning with a laser densitometer (Helena Laboratories, Beaumont, TX). The IGF-I and IGF-II densitometric values were corrected with respective 28S values (to eliminate variations in RNA loading).
Reverse transcription-polymerase chain reaction (RT-PCR)
The expressions of IGF-I, type I IGF receptor, and type II IGF/ mannose-6-phosphate receptor mRNAs were studied by RT-PCR am- plification according to previously described methods (19). One micro- gram of total RNA from each specimen was used for RT reaction at 37 C for 60 min with 100 U Moloney murine leukemia virus reverse transcriptase enzyme (Bethesda Research Laboratories, Gaithers- burg, MD). The RT reaction mixture contained 10 mm dithiothreitol, 0.5 mM of each deoxy-NTP (Perkin-Elmer/Cetus, Norwalk, CT), 5 U human placental RNAse inhibitor (Amersham), and oligo-(dT)15 (Boehringer Mannheim), which was used as a primer. After incubation, the volume was further diluted to 20 uL, and 1 uL of this mixture was used for PCR amplification.
The amplification primers (Table 1), based on previously reported sequences for IGF-I (20), type I IGF receptor (6), type II IGF receptor (7), and 8-actin (21), were synthesized with an Applied Biosystems 380B DNA synthesizer at the Cancer Biology Laboratory, University of Hel- sinki. The PCR reaction volume was 50 uL. One microliter of RT mixture was combined with 49 uL PCR mixture, which consisted of 5 uL 10- fold concentrated reaction buffer, 1 uL of each dNTP (10 mm stock solutions; final concentration, 0.2 mm), 0.5 uL 5’- and 3’-oligonucleotide primers (50 uM stock solutions; final concentration, 0.5 MM), 0.25 uL tetramethylammonium chloride (10 mm stock solution, final concentra- tion 50 AM) (22), 0.5 ML (2.5 U) AmpliTaq enzyme (Perkin-Elmer), and 38.25 uL water. After adding two drops of mineral oil (Perkin-Elmer), the reactions were heated to 94 C for initial denaturation (90 s), then immediately cycled using a Hybaid thermal reactor (Teddington, United Kingdom). After 40 cycles (94 C, 30 s for denaturation; 58 C, 30 s for annealing; and 72 C, 90 s for elongation), 10-uL aliquots were run in a 1.5% agarose gel with mol wt marker (øX174 DNA-HaeIII digest) and stained with ethidium bromide. In the B-actin PCR, only 35 cycles (without tetramethylammonium chloride) were run. The PCR products were Southern blotted onto Hybond N filters and hybridized with internal oligonucleotides (type I and type II IGF receptors) or with respective cDNA (IGF-I) (15) to confirm the specificity of the PCR products. The sequence of the type I IGF receptor internal oligonucleo- tide was 5’-TTC TCG CTG ATC CTC AAC TTG TGA TCC-3’, corre- sponding to nucleotides 2653-2679 (6). The type II IGF receptor internal oligonucleotide was 5’-GTC CTC CAC TCA AAG TAG TGC ACA CAT-3’, corresponding to nucleotides 591-617 (7). The oligonucleotides were 3’-end labeled with [a-32P]deoxy-CTP (6000 Ci/mmol; Amersham) and terminal transferase (Boehringer Mannheim). The hybridization and washing conditions for oligonucleotide probes were previously described (13). Autoradiography was performed as described for Northern blots (see above).
Immunohistochemistry
Tissues were fixed in formalin and embedded in paraffin. Five-micron paraffin sections were cut and used for IGF-II immunostaining after deparaffinization. The sections were incubated with a rabbit polyclonal IGF-II antiserum (23) at a 1:20 dilution overnight at 4 C. The specificity was controlled by replacing the antiserum with normal rabbit serum and preabsorbing the antiserum with an excess of IGF-II (10 µg/mL). Im- munostaining was performed by using a Super Sensitive Multilink immunostaining kit (BioGenex, San Ramon, CA). After incubation with biotinylated second antibody, the sections were extensively washed and treated with alkaline phosphatase-conjugated streptavidin and substrate solution according to the kit protocol. Endogenic alkaline phosphatase was blocked by including 10 mm levamisole in the substrate solution. Fast red was used as a chromogen. The slides were counterstained with Mayer’s hematoxylin before microscopic examination.
| Gene | Sequence | Nucleotides | Product (bp) | Ref. no. |
|---|---|---|---|---|
| IGF-I | 5'-primer: AAATCA GCA GTCTTCCAACC 3'-primer: CTTCTGGGTCTTGGGCATGT | 190-209 565-584 | 395 | 20 |
| IGF-IR | 5'-primer: AACCACGAGGCTGAGAAGCT 3'-primer: CAGCATAATCACCAACCCTC | 2464-2483 2891-2910 | 447 | 6 |
| IGF-IIR | 5'-primer: TCAACATCTGTGGAAGTGTG 3'-primer: GAATAGAGAAGTGTCCGGATCGGAGTC | 344-363 745-771 | 428 | 7 |
| B-Actin | 5'-primer: CCCAGGCACCAGGGCGTGAT 3'-primer: TCAAACATGATCTGGGTCAT | 153-172 396-415 | 263 | 21 |
5’-Primers are sense and 3’-primers are antisense sequences. The lengths of the expected PCR products are given in basepairs (bp). IGF-IR, Type I IGF receptor; IGF-IIR, type II IGF receptor.
Results
IGF-I
IGF-I gene expression was first studied with a cDNA probe from total cellular RNA. However, IGF-I mRNA was not detectable on either Northern or dot blots. After this prelim- inary negative result, we constructed a riboprobe to increase the sensitivity. We also measured IGF-I mRNA with RT- PCR, which is a very sensitive mRNA detection method. With the IGF-I riboprobe, we detected low mRNA levels in all of the studied specimens using dot blot hybridizations (Fig. 1). The results from all of the studied specimens are summarized in Table 2. IGF-I mRNA levels in normal adult adrenals were about the same as those in the fetal adrenal.
Cushing’s carcinoma
Cushing’s carcinoma
Conn’s adenoma
normal adrenal
bilateral hyperplasia
pheochromocytoma
normal adrenal
IGF-I
28 S
IGF-II
28 S
| Tissue | n | IGF-I | IGF-II |
|---|---|---|---|
| Normal adult adrenal | 3 | 100 (77-135) | 100 (97-105) |
| Adrenocortical carcinoma | 1 | 88 | 335 |
| (nonfunctional) | |||
| Adrenocortical carcinoma | 2 and 3ª | 59 (43-74) | 1252 (1027-1630) |
| (Cushing's syndrome) | |||
| Adjacent gland | 2 | 252 (76-428) | |
| Adrenocortical hyperplasia | 2 | 118 (85-151) | 80 (74-86) |
| (Cushing's disease) | |||
| Nodular hyperplasia | 5 | 168 (85-410) | 195 (43-412) |
| Adjacent gland | 3 | 86 (77-94) | 98 (93-105) |
| Adenoma (nonfunctional) | 3 | 90 (84-98) | 64 (43-78) |
| Adenoma (Cushing) | 5 and 7b | 129 (57-199) | 123 (43-222) |
| Adenoma (Conn) | 5 | 123 (72-167) | 107 (54-230) |
| Adjacent gland | 4 | 72 (50-83) | 101 (51-156) |
| Pheochromocytoma | 4 | 63 (53-80) | 517 (202-837) |
| Adjacent gland | 1 | 58 | 125 |
| Myelolipoma | 1 | 82 | 86 |
| Fetal adrenal | 1 | 112 | 1428 |
| Fetal liver | 1 | 50 | 1175 |
The values were calculated from scanned autoradiographic signals of two dot blot filters. The RNA specimens (2 ug) were blotted onto two similar dot blot filters, as described in Materials and Methods. The filters were hybridized with an IGF-I riboprobe and an IGF-II cDNA probe. After autoradiography, the IGF probes were stripped, and the filters were rehybridized with a 28S cDNA probe. The IGF signals were normalized with respective 28S values. The means and ranges (in parentheses) of the normalized densitometric scanning results are shown. The mean of normal adult adrenals was adjusted to 100. ª n = 2 for IGF-I and n = 3 for IGF-II. n = 5 for IGF-I and n = 7 for IGF-II.
No elevated IGF-I mRNA levels were found in any of the tumors studied. In fact, adrenocortical carcinomas and pheo- chromocytomas tended to have less IGF-I mRNA than nor- mal adrenals. The highest IGF-I mRNA content (4.1-fold higher than in the normal gland) was found in one nodular hyperplastic adrenal with no steroid overproduction. How- ever, four other similar cases showed no increased IGF-I mRNA content. As the detected IGF-I mRNA levels were very low, and part of the signal may represent unspecific hybridization, we studied IGF-I gene expression with a more sensitive and specific RT-PCR analysis. With this method, we could easily detect IGF-I expression in all of the tissues studied (Fig. 2).
IGF-I
kb
1 2 3 4 5 6 7 8 9 10
872 -
603 -
- 395 bp
310 -
281 -
- 395 bp
IGF-II
IGF-II mRNA levels were examined by dot blotting (Fig. 1), and if there was enough RNA, Northern blots were also prepared (Fig. 3). The IGF-II mRNA results are summarized in Table 2. Very high IGF-II mRNA levels in Cushing’s carcinoma (n = 3) and moderately elevated levels in a non- functioning carcinoma were detected (Table 2). The IGF-II mRNA levels in Cushing’s carcinoma were comparable to those in human fetal adrenal, where the IGF-II mRNA content is among the highest during fetal life (11, 24). We also detected elevated IGF-II mRNA levels in pheochromo- cytomas, as described previously (25, 26). IGF-II levels were not elevated in adrenocortical adenomas or bilateral hyper- plasia (Cushing’s disease). In two cases of nodular hyperpla- sia without steroid overproduction, 3.9- and 4.1-fold higher IGF-II mRNA levels were seen than in normal adrenals, but in three other cases, the IGF-II mRNA content was not high. The sizes of the different IGF-II transcripts were analyzed by Northern blotting (Fig. 3). The major bands in Cushing’s carcinomas were 6.0, 4.8, and 2.0 kilobases, although some additional bands were seen. Furthermore, the same band pattern was present in pheochromocytomas, although their relative intensity varied slightly (Fig. 2, lanes 5, 7, and 8). Previously, it has been shown that IGF-II mRNA levels are up-regulated in human fetal adrenals by ACTH (11, 12). This may be one of the mechanisms regulating human fetal adrenal growth. However, ACTH was not able to increase IGF-II mRNA accumulation in primary cultures prepared
IGF-II
kb
1 2 3 4 5 6 7 8 9 10 11
6.0
4.8
- 28 S
2.2
-18 S
28 S
from normal adult adrenals (Fig. 4). This was not due to the ineffectiveness of ACTH in these cultures, as steroidogenic enzyme P450c17 mRNA increased with ACTH treatment (Fig. 4), as described previously (13). In some situations, IGF- II mRNAs may not be translated efficiently (25). Therefore, we performed immunostaining for two of Cushing’s carci- nomas, which showed elevated IGF-II mRNA levels. A rep- resentative result is shown in Fig. 5, where it can be seen that most of the tumor cells express IGF-II-like immunoreac- tivity. Normal adrenal gland stained only weakly with IGF- II antiserum (not shown).
IGF receptors
Type I and type II IGF receptor mRNA levels in the tumors were first investigated by Northern blotting of total RNA specimens with oligonucleotide probes. With this method, we could not detect either type of IGF receptor mRNA. Keeping in mind the expected low copy number of receptor mRNA molecules, we turned to a more sensitive RT-PCR method. It was found that all of the studied tissues contained both type I and type II receptor mRNAs (Figs. 6 and 7).
control, adult
ACTH, adult ACTH, fetal
IGF-II
6.0 kb
4.8 kb
- 28 S
2.2 kb
18 S
-
P450c17
2.0 kb
-
Y-actin
- 2.0 kb
Discussion
Our results show that IGF-II mRNA levels are very high in hormonally active adrenocortical carcinomas and moder- ately elevated in pheochromocytomas. IGF-I mRNA levels were, in general, not elevated in any of these tumors. In fact, adrenocortical carcinomas and pheochromocytomas tended to have lower IGF-I mRNA contents than normal adrenals. All of the tumors studied also contained mRNA for both type I and type II IGF receptors. Our study is in agreement with the results of Schneid et al. (27), who found elevated IGF-II mRNA levels in one adrenocortical carcinoma. In another recent study, it was found that IGF-I immunoreactivity was higher in adrenocortical carcinomas than in adenomas, and the majority of both benign and malignant adrenocortical tumors contained type I IGF receptor immunoreactivity (28).
Prior studies have shown that the IGFs may be important auto/paracrine regulators of normal adrenocortical functions. Very intensive IGF immunoreactivity (predominantly IGF-II)
A
B
and high IGF-II mRNA levels have been detected in human fetal adrenals (11, 24, 29). In cultured human fetal adrenal cells, ACTH stimulates the accumulation of IGF-II mRNA, suggesting that IGF-II may mediate local growth of the adrenal gland in response to ACTH (11, 12). In the normal adult adrenal gland (human), IGF-II mRNA levels are very low (11), as in most other adult tissues studied. Bovine adult adrenals have been shown to produce IGF-I, and the pro- duction is stimulated by ACTH, angiotensin-II, and fibroblast growth factor (30). Both fetal and adult adrenals contain IGF- I receptors (31, 32). We found that IGF-II mRNAs were not up-regulated by ACTH in normal adult adrenocortical cells in culture. This unresponsiveness to ACTH suggests that IGF-II may not be an important growth regulator in normal adult adrenals. This view is further supported by our finding that IGF-II mRNA was not increased in bilateral adrenocor-
IGF-IR
kb
1
2 3 4 5 6 7 8 9 10 11
872 -
603 -
- 447 bp
310 - 281 -
- 447 bp
tical hyperplasias, where the adrenals are chronically stimu- lated by excessive ACTH. We also cultured one hyperplastic adrenal, and the cells in this culture did not show elevated IGF-II mRNA levels after ACTH incubations (data not shown). Therefore, it seems likely that factors other than IGF-II are responsible for bilateral adrenal hyperplasia in Cushing’s disease. Our result accords with the finding that IGF-II (and IGF-I) mRNA did not increase in adult rat adrenals in vivo after ACTH infusion (33).
The most prominent finding of the present study is the high IGF-II mRNA content in three Cushing’s carcinomas. The mechanism of this amplification remains unknown at present. Recently, a G-protein oncogene gip 2 (mutated gene for the a-chain of Gi2) was found in 3 of 11 adrenocortical carcinomas (34). The role of the protein product of this oncogene is not known, but if the net effect of its actions could be permanently activated adenylate cyclase, then this could (at least in part) lead to elevated IGF-II levels. Another recent study shows that the Wilms’ tumor suppressor gene wt 1 (located on chromosome 11p13 adjacent to the IGF-II gene) functions as a potent repressor of IGF-II gene transcrip- tion (35). In Wilms’ tumor, the wt 1 is inactivated, leading to elevated IGF-II levels. Interestingly, in adrenocortical carci- noma, loss of alleles on chromosomes 11p (36, 37), 13q, and 17p (37) have been found. It is tempting to speculate that
IGF-IIR
kb
1
2
3
4
5
7
8 9 10 11
872 -
603 -
-428 bp
310 -
281-
- 428 bp
some of these chromosomal alterations may have a connec- tion(s) with the high IGF-II mRNA levels in adrenocortical carcinomas, as do wt 1 alterations in Wilms’ tumors.
The mitogenic activities of both IGF-I and IGF-II are thought to be mediated through the type I IGF receptor, because cell growth can be inhibited by a monoclonal anti- body, a-IR-3, that specifically blocks this receptor (38). How- ever, it has been demonstrated that IGF-II may promote growth through the type II IGF receptor in a leukemia cell line (39) and in human breast cancer cells (40). In the present study we showed that both type I and type II IGF receptor mRNAs are found in all of the adrenocortical tumors studied as well as in normal glands. Therefore, the effects of IGF-II in adrenocortical tumors may be mediated via both of these receptors. In the future it would be important to study the functional significance of type I and type II IGF receptors in adrenocortical tumors.
In conclusion, our results together with the earlier studies suggest that the IGFs may be involved in the auto/paracrine growth regulation of some adrenocortical tumors.
Acknowledgments
Ms. Merja Haukka, Ms. Eija Teva, and Ms. Päivi Laitinen are thanked for technical assistance. We thank Dr. Werner F. Blum (University Children’s Hospital, Tubingen, Germany) for the IGF-II antiserum.
References
1. Sporn MB, Roberts AB. 1985 Autocrine growth factors and cancer. Nature. 313:745-747.
2. Heldin C-H, Westermark B. 1989 Growth factors as transforming proteins. Eur J Biochem. 184:487-496.
3. Cross M, Dexter TM. 1991 Growth factors in development, trans- formation, and tumorigenesis. Cell. 64:271-280.
4. Aaronson SA. 1991 Growth factors and cancer. Science. 254:1146- 1153.
5. Rechler MM, Nissley SP. 1990 Insulin-like growth factors. In: Sporn MB, Roberts AB, eds. Handbook of experimental pharmacol- ogy. Berlin, Heidelberg: Springer-Verlag; pp 263-367.
6. Ullrich A, Gray A, Tam AW, et al. 1986 Insulin-like growth factor I receptor primary structure: comparison with insulin receptor sug- gests structural determinants that define functional specificity. EMBO J. 5:2503-2512.
7. Morgan DO, Edman JC, Standring DN et al. 1987 Insulin-like growth factor II receptor as a multifunctional binding protein. Nature. 329:301-307.
8. Daughaday WH. 1990 The possible autocrine/paracrine and en- docrine roles of insulin-like growth factors of human tumors. Endocrinology. 127:1-4.
9. Nakanishi Y, Mulshine JL, Kasprzyk PG et al. 1988 Insulin-like growth factor-I can mediate autocrine proliferation of human small cell lung cancer cell lines in vitro. J Clin Invest. 82:354-359.
10. El-Badry OM, Romanus JA, Helman LJ, Cooper MJ, Rechler MM, Israel MA. 1989 Autonomous growth of a human neuroblastoma cell line is mediated by insulin-like growth factor II. J Clin Invest. 84:829-839.
11. Voutilainen R, Miller WL. 1988 Developmental and hormonal regulation of mRNAs for insulin-like growth factor II and steroido- genic enzymes in human fetal adrenals and gonads. DNA. 7:9-15.
12. Voutilainen R, Miller WL. 1987 Coordinate tropic hormone regu- lation of mRNAs for insulin-like growth factor II and the cholesterol side-chain-cleavage enzyme, P450scc, in human steroidogenic tis- sues. Proc Natl Acad Sci USA. 84:1590-1594.
13. Ilvesmäki V, Voutilainen R. 1991 Interaction of phorbol ester and adrenocorticotropin in the regulation of steroidogenic P450 genes in human fetal and adult adrenal cell cultures. Endocrinology. 128:1450-1458.
14. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. 1979 Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry. 18:5294-5299.
15. Bell GI, Merryweather JP, Sanchez-Pescador R et al. 1984 Se- quence of a cDNA clone encoding human preproinsulin-like growth factor II. Nature. 310:775-777.
16. Gunning P, Ponte P, Okayama H, Engel J, Blau H, Kedes L. 1983 Isolation and characterization of full-length cDNA clones for human a-, B- and y-actin mRNAs: skeletal but not cytoplasmic actins have an amino-terminal cysteine that is subsequently removed. Mol Cell Biol. 3:787-795.
17. Chung B, Picado-Leonard J, Haniu M et al. 1987 Cytochrome P450c17 (steroid 17a-hydroxylase/17, 20-lyase): cloning of human adrenal and testis cDNAs indicates the same gene is expressed in both tissues. Proc Natl Acad Sci USA. 84:407-411.
18. Arnheim N. 1979 Characterization of mouse ribosomal gene frag- ments purified by molecular cloning. Gene. 7:83-96.
19. Rappolee DA, Wang A, Mark D, Werb Z. 1989 Novel method for studying mRNA phenotypes in single or small numbers of cells. J Cell Biochem. 39:1-11.
20. Rotwein P. 1986 Two insulin-like growth factor I messenger RNAs are expressed in human liver. Proc Natl Acad Sci USA. 83:77-81.
21. Ponte P, Ng S-Y, Engel J, Gunning P, Kedes L. 1984 Evolutionary conservation in the untranslated regions of actin mRNAs: DNA sequence of a human beta-actin cDNA. Nucleic Acids Res. 12: 1687-1696.
22. Hung T, Mak K, Fong K. 1990 A specificity enhancer for polymerase
chain reaction. Nucleic Acids Res. 18:4953.
23. Blum WF, Ranke MB, Bierich JR. 1988 A specific radioimmuno- assay for insulin-like growth factor II: the interference of IGF binding proteins can be blocked by excess IGF-I. Acta Endocrinol (Copenh). 118:374-380.
24. Han VKM, Lund PK, Lee DC, D’Ercole AJ. 1988 Expression of somatomedin/insulin-like growth factor messenger ribonucleic acids in the human fetus: identification, characterization and tissue dis- tribution. J Clin Endocrinol Metab. 66:422-429.
25. Haselbacher GK, Irminger J-C, Zapf J, Ziegler WH, Humbel RE. 1987 Insulin-like growth factor II in human adrenal pheochromo- cytomas and Wilms tumors: expression at the mRNA and protein level. Proc Natl Acad Sci USA. 84:1104-1106.
26. Irminger J-C, Rosen KM, Humbel RE, Villa-Komaroff L. 1987 Tissue-specific expression of insulin-like growth factor II mRNAs with distinct 5’untranslated regions. Proc Natl Acad Sci USA. 84:6330-6334.
27. Schneid H, Seurin D, Noguiez P, Le Bouc Y. 1992 Abnormalities of insulin-like growth factor (IGF-I and IGF-II) genes in human tumor tissue. Growth Regul. 2:45-54.
28. Kamio T, Shigematsu K, Kawai K, Tsuchiyama H. 1991 Immu- noreactivity and receptor expression of insulinlike growth factor I and insulin in human adrenal tumors. Am J Pathol. 138:83-91.
29. Han VKM, Hill DJ, Strain AJ, Towle AC, Lauder JM, Underwood LE, D’Ercole AJ. 1987 Identification of somatomedin/insulin-like growth factor immunoreactive cells in the human fetus. Pediatr Res. 22:245-249.
30. Penhoat A, Naville D, Jaillard C, Chatelain PG, Saez JM. 1989 Hormonal regulation of insulin-like growth factor I secretion by bovine adrenal cells. J Biol Chem. 264:6858-6862.
31. Shigematsu K, Niwa M, Kurihara M, Yamashita N, Kawai K, Tsuchiyama H. 1989 Receptor autoradiographic localization of in- sulin-like growth factor-I (IGF-I) binding sites in human fetal and adult adrenal glands. Life Sci. 45:383-389.
32. Pillion DJ, Arnold P, Yang M, Stockard CR, Grizzle WE. 1989 Receptors for insulin and insulin-like growth factor-I in the human adrenal gland. Biochem Biophys Res Commun. 165:204-211.
33. Townsend SF, Dallman MF, Miller WL. 1990 Rat insulin-like growth factor-I and -II mRNAs are unchanged during compensatory adrenal growth but decrease during ACTH-induced adrenal growth. J Biol Chem. 265:22117-22122.
34. Lyons J, Landis CA, Harsh G et al. 1990 Two G protein oncogenes in human endocrine tumors. Science. 249:655-659.
35. Drummond IA, Madden SL, Rohwer-Nutter P, Bell GI, Sukhatme VP, Rauscher III FJ. 1992 Repression of the insulin-like growth factor II gene by the Wilms tumor suppressor wt 1. Science. 257: 674-678.
36. Henry I, Grandjouan S, Couillin P et al. 1989 Tumor-specific loss of 11p15.5 alleles in del 11p13 Wilms tumor and in familial adre- nocortical carcinoma. Proc Natl Acad Sci USA. 86:3247-3251.
37. Yano T, Linehan M, Anglard P et al. 1989 Genetic changes in human adrenocortical carcinomas. J Natl Cancer Inst. 81:518-523.
38. Conover CA, Misra P, Hintz RL, Rosenfeld RG. 1986 Effect of an anti-insulin-like growth factor I receptor antibody on insulin-like growth factor II stimulation of DNA synthesis in human fibroblasts. Biochem Biophys Res Commun. 139:501-508.
39. Tally M, Ii CH, Hall K. 1987 IGF-2 stimulated growth mediated by the somatomedin type 2 receptor. Biochem Biophys Res Com- mun. 148:811-816.
40. Mathieu M, Rochefort H, Barenton B, Prebois C, Vignon F. 1990 Interactions of cathepsin-D and insulin-like growth factor-II (IGF- II) on the IGF-II/mannose-6-phosphate receptor in human breast cancer cells and possible consequences on mitogenic activity of IGF- II. Mol Endocrinol. 4:1327-1335.