DAX1 Gene Expression Upregulated by Steroidogenic Factor 1 in an Adrenocortical Carcinoma Cell Line
Eric Vilain, Weiwen Guo, Yao-Hua Zhang, and Edward R. B. McCabe1
Department of Pediatrics and Program in Human Genetics, University of California Los Angeles School of Medicine, Los Angeles, California 90095-1752
Received April 16, 1997
Two nuclear hormone receptor superfamily mem- bers, DAX1 and SF1, are required for normal adrenal cortical development. Mutations in DAX1 are respon- sible for X-linked adrenal hypoplasia congenita (AHC) and hypogonadotropic hypogonadism. Ste- roidogenic Factor 1 (SF1) regulates the expression of a number of steroidogenic genes and a putative SF1 response element (SF1-RE) in the DAX1 promoter which binds SF1 specifically. Therefore, we examined deletions in the DAX1 promoter driving expression of ß-galactosidase, with and without coexpression of SF1, in the human adrenocortical carcinoma cell line NCI-H295. We defined the DAX initiation start site and localized the putative SF1-RE at -135 to -143 bp. Loss of the putative SF1-RE region or specific re- moval of the 9-bp SF1 site resulted in decreased tran- scriptional activity by 2.3- to 2.5-fold. When cotrans- fected with 1550 bp of the DAX1 promoter, an SF1- containing expression vector increased the transcrip- tional activity of the DAX1 promoter by 4-fold. No sig- nificant change above baseline occurred when the cells were cotransfected with the 1541-bp fragment containing the entire 1550-bp promoter region minus the 9-bp SF1-RE. We conclude that the SF1-RE is an enhancer element within the DAX1 promoter and speculate that SF1 may be a transcription factor that acts, at least in part, through DAX1 for normal adre- nal cortical development. @ 1997 Academic Press
Recent advances in the understanding of adrenal development have highlighted the role of two genes,
1 To whom correspondence should be addressed at Department of Pediatrics, 22-412 MDCC, UCLA School of Medicine, 10833 LeConte Avenue, Los Angeles, CA 90095-1752. Fax: (310) 206- 4584. E-mail: emccabe@pediatrics.medsch.ucla.edu.
DAX1 and SF1, in promoting the proper formation of the adrenal cortex.
Mutations in DAX1 are responsible for an inher- ited disorder of the development of the adrenals, X- linked adrenal hypoplasia congenita (AHC) (1-4). This disorder is characterized by the absence of the permanent zone of the adrenal cortex and by struc- tural disorganization of the fetal cortex (5). The adre- nal cortical cells appear to be fetal adrenal cells that are larger than normal and have nuclear inclusions due to cytoplasmic invaginations (6). AHC is lethal if untreated because of severe adrenal insufficiency early in infancy. DAX1 maps to the Xp21 region, in the dosage-sensitive sex reversal locus (DSS), a region that is duplicated in some 46, XY patients with an intact SRY gene and ambiguous or female genitalia (7,8). DAX1 is therefore named for DSS- AHC on the X chromosome gene 1. DAX1 encodes a novel member of the nuclear hormone receptor su- perfamily. It contains a conserved ligand-binding do- main, but does not exhibit a conventional DNA-bind- ing domain. This new structure is found in only one other orphan nuclear hormone receptor, the small heterodimer partner (SHP) (9). Point mutations in the DAX1 open reading frame have been identified in patients with the associated X-linked AHC and hypogonadotropic hypogonadism (1-4). DAX1 is ex- pressed in the hypothalamus, the pituitary, the ad- renal cortex, and the gonads, consistent with the phenotypes of patients with mutations in this gene (1,10,11). The origin of the hypogonadotropic hypo- gonadism in these patients appears to be due to a disruption of the normal action of DAX1 at both the hypothalamic and the pituitary levels (4).
Steroidogenic Factor 1 (SF1) is also involved in
the development of the adrenals, as well as the other components of the hypothalamic-pituitary-adre- nal/gonadal axis (12). SF1 maps to 9q33 in humans (13) and is an orphan nuclear hormone receptor ini- tially shown to control the expression of the cyto- chrome P450 steroid hydroxylase genes in the go- nads and adrenal cortex (14). SF1 has the ability to bind to variations of the response element PyCAAG- GPyCPu (containing the consensus core AGGTCA element), which resembles a nuclear receptor bind- ing half-site (15) and is found in the promoter of a number of genes, including aromatase (16), Mülle- rian inhibiting substance (17), the cholesterol side- chain cleavage enzyme (18), the a-subunit of the pi- tuitary glycoprotein hormones (19), and the luteiniz- ing hormone 3-subunit (20,21).
Our group and other groups hypothesized that DAX1 and SF1 may act in concert during the devel- opment of the hypothalamic-pituitary-adrenal/go- nadal axis (22,23), since SF1 and DAX1 co-localize in multiple cell lineages of this axis (1,10,11,24,25). Furthermore, there are indirect arguments support- ing the hypothesis that SF1 and DAX1 act sequen- tially during adrenal development: (i) SF1 is ex- pressed in the mouse adrenal primordium on Em- bryonic Day 11 (24), 36 h earlier than DAX1, which is detected in the same tissue at Embryonic Day 12.5 (11); and (ii) the phenotype of patients with mutations in DAX1 is slightly less severe than the phenotype of the SF1 knockout mouse, which com- pletely lacks adrenal glands and gonads (26).
Recently, we identified a putative SF1 response element (SF1-RE) in the DAX1 promoter that spe- cifically bound SF1 (22). In the current study, we show that SF1 is able to enhance the transcriptional activity of the DAX1 promoter in adrenocortical cells and the SF1-RE in the DAX1 promoter is required for the enhanced expression in cotransfection experi- ments.
MATERIALS AND METHODS
RNase protection and 5’ rapid amplification of cDNA ends by PCR. RNase protection was per- formed using a 32P-labeled probe transcribed in the antisense orientation. A 282-bp fragment overlap- ping the putative start site region identified by 5’ rapid amplification of cDNA ends by PCR (5’RACE- PCR) was generated by PCR and cloned into the BamHI/HindIII sites of pBluescript (SK+) (Strata- gene). The oligonucleotides DX-1, containing a BamHI site (5’-AACTAGTGGATCCTCTCTGCCCACCCCG- GGCTCAT-3’), and DX-2, containing a HindIII site
(5’-TATCGATAAGCTTCACACACCGCCCGCCTCC- GCGC-3’), were used to generate this fragment. After linearization with HindIII, the plasmid was transcribed with T3 RNA polymerase in the pres- ence of [32P]CTP. Then the radiolabeled probe (4 X 105 cpm) was hybridized with 10 µg of RNA isolated from human adrenals and 10 mg of yeast tRNA. To reduce secondary structure, RNA was precipitated in ethanol and resuspended for 10 min in a 4-pl solu- tion containing 5 mM methylmercury hydroxide. One microliter of 6-mercaptoethanol (700 mM) was added, followed by 30 ul of hybridization solution containing 75% deionized formamide, 20 mM Tris- HCl, pH 7.5, 500 mM NaCl, and 1 mM EDTA, pH 7.5. After 7 min of denaturation at 85℃, hybridiza- tion was performed at 45℃ for 18 h. Hybridization with the radiolabeled probe was also performed in a control tube containing 10 µg of yeast tRNA. Follow- ing the hybridization, the RNA:RNA hybrid was di- gested for 30 min at 37℃ in a solution containing 40 µg . ml-1 of ribonuclease A (Sigma) and 2 µg · ml-1 of ribonuclease T1 (Sigma). The reaction was stopped by adding SDS to a final concentration of 0.1% and proteinase K to a final concentration of 300 µg· ml-1 and incubation for 30 min at 37℃. The hybrid was extracted with phenol:chloroform (1:1 v/v), precipitated with 2.5 vol of ethanol, and electro- phoresed in a 6% polyacrylamide urea gel. In the same gel, control yeast tRNA, radiolabeled probe, and an M13 sequencing reaction performed with a -40 primer (U.S. Biochemicals) were also electro- phoresed. The gel was autoradiographed by expo- sure to X-OMAT AR5 film (Kodak) for 48 h.
5’RACE-PCR (27) was performed using human adrenal RNA (purchased from Clontech) with oligo- nucleotide DX-3 (5’-GTGGTCTTCACCACAAAAG- 3’) for extension and internal oligonucleotide DX-4 (5’-CACGCGTCGACGCAGCGGTACAGGAGTGC- CAC-3’) containing a SalI site for PCR, according to the instructions of the 5’RACE system (Gibco-BRL). The amplified 5’ end of the gene was subsequently cloned into the SalI site of pBluescript (SK+) (Stra- tagene), and the longest inserts were sequenced.
Cell culture. The NCI-H295 cells were obtained from the American Type Culture Collection (Rock- ville, MD) and were cultured at 37℃ in RPMI with 2% fetal calf serum, L-glutamine (2 mM), penicillin (100 units . ml-1)/streptomycin (100 mg· ml-1) at a ratio of 1 unit . ml-1 to 1 mg . ml-1, insulin (5 mg . ml-1), transferrin (5 mg · ml-1), selenium (5 ng . ml-1), 17 6-estradiol (10-8 M), and hydrocortisone (10-8 M), according to Staels et al. (28). They were maintained
in a humidified atmosphere containing 10% CO2 and 90% air.
Reporter plasmids. To study the transcriptional regulation of DAX1, transient transfection experi- ments were performed with various 5’ deletion con- structs derived from p-1550/+30GAL, a plasmid con- taining 1550 bp of the human DAX1 promoter plus 30 bp of the 5’ unstranslated region, linked to the ß-galactosidase reporter gene, in the vector p-ßgal Basic (Clontech). Each fragment contained the same 3’ terminus at +30 with variable amounts of 5’ flanking DNA, generated by PCR. All deletion con- structs were sequenced by automated sequencing (ABI-373, Applied Biosystems). The site-directed mutagenesis of the putative SF1 binding site was performed using the QuikChange site-directed mu- tagenesis kit (Stratagene). Briefly, p-1550/+30GAL was denatured and annealed with the complemen- tary primers DX-SFA (5’-CCCGCCCCTTCGAACC- ATGGGCGAACACACCGGAGC-3’) and DX-SFB (5’-GCTCCGGTGTGTTCGCCCATGGTTCGAAG GGGCGGG-3’) deleted for the putative SF1 re- sponse element. A cycling reaction with Pfu polymer- ase was performed for 18 cycles: 30 s at 95℃, 1 min at 55°℃, and 20 min at 68℃. DpnI (10 units) enzyme was added to the amplification reaction in order to digest the methylated, nonmutated parental DNA template. After a 1-h incubation at 37℃, the reaction was used to transform competent XL1-Blue Esche- richia coli and the transformed organisms were plated on agar with ampicillin (2.5 mg), X-gal (800 ug), and IPTG (800 µg). Ten white colonies were obtained. Two of the colonies contained the appro- priate deletion for the SF1 site, as checked by auto- mated sequencing.
The mouse SF1 cDNA, cloned downstream from a CMV promoter, was used to overexpress SF1 in cotransfection experiments with DAX1 promoter/ GAL reporter gene constructs. pCMV with no insert was used as a control.
Transient transfections and ß-galactosidase assays. A total of 5 x 106 NCI-H295 cells were transfected by electroporation at 250 mV, capacitance 960 uf using a Gene Pulser (Bio-Rad). Transfections were performed with 25 µg of the DAX1 promoter con- structs and 1 µg of pGL2 control vector (Promega) encoding luciferase in order to monitor the transfec- tion efficiencies. After 48 h of incubation, the cells were rinsed twice with phosphate-buffered saline, harvested by scraping, resuspended in 75 ul of lysate buffer (100 mM potassium phosphate, pH 7.8), and lysed by three freeze/thaw cycles. A chemilumines-
cent substrate was then added to 30 ul of extract, according to the Luminescent 3-Galactosidase Ge- netic Reporter System instructions (Clontech). The light signal was recorded as 5-s integrals on a LU- MAT LB 9501 luminometer (EGG-Berthold). Galac- tosidase activity was normalized to the level of lucif- erase activity, measured as described previously (29). Results are shown as the mean ± SE of nine samples in three independent experiments. Statisti- cal analysis was performed with an unpaired t test.
RESULTS
The first step in the characterization of human DAX1 promoter was the identification of the human DAX 1 initiation start site by 5’RACE PCR and by RNase protection. The resulting putative start site is shown in Fig. 1A. RNase protection (Fig. 1B) con- firmed this exact start of initiation of transcription. The length of the protected fragment was 186 bp, and, therefore, the initiation start site was located 30 bp upstream from the first ATG. In further stud- ies, this initiation start site will be referred to as +1 and is marked on the DAX1 gene nucleotide se- quence (Fig. 1A). The putative SF1 site was then localized at position -143 to -135 bp. A comparison of the first 313 bp of the human promoter region (up to the first ATG) with the mouse promoter region (30) is also shown in Fig. 1A. It reveals an identity of 80% between the first 120 bp (-90 to +30) which include the TATA base. The 193 bp upstream (-283 to -91) show an identity of only 50%, mainly due to a short highly conserved region (-181 to -123) with an identity of 72%, which contains the SF1-RE. In- terestingly the transcriptional start sites for mouse and human cDNAs are at different positions relative to the initial ATG, so that, despite a 16-bp gap in the mouse sequence, to establish alignment, the pu- tative SF1-RE sites are at very similar positions: -143 to -135 in human and -144 to - 136 in mouse.
Promoter sequences required for normal human DAX1 expression were characterized by transfecting various promoter constructs into the adrenocortical cell line NCI-H295. Transfection of 1550 bp of DAX1 promoter in NCI-H295 cells was sufficient to drive a significant level of expression, 10-fold higher than the background activity of the vector containing ß-galac- tosidase alone. Reverse transcriptase-PCR results showed that these cells expressed both DAX1 and SF1 (data not shown). The delineation of the region of the DAX1 promoter responsible for its expression came from the study of the reporter gene (3-galactosi- dase) activity in sequential 5’-deletion constructs
A
CAGCATCCAGGCGCTCGCTCTCCTCCGGTCTTCCTGAGACAGGGA -240
catgctagctct … tctcttccccaggtagaggcaggaggg -246 . .
* .
*
AAGGGGTAATGAGAGGAAGGAGGAAAGT.GTCCAGGAGCTCCCACGCTGC -191
gtggagtgaagaaggaaaggtggtatgtggtatgctagttccagtgctga -196 . .
. .
.
TGTTCTTCC … ATTTCCAGCTTTTAAAGAGCACCCGCCCCTTCGAACC -145
gactctcccttggatttccagcttctagggagtgtttgcccctttgagct -146 . -
. * .
SF1-RE
ACCGAGGTCATGGGCGAACACACCGGAGCGCAGACCGCGCCCCCCCGCAC -95
ttcgaggtcatggccacacacattcaagcaca. aa -112
.
.
.
. .
ACACCGCCCGCCTCCGCGCCCTTGCCCAGACCGAGGCGGCCGACGCGCCT -45
ggcgcgtccccctccgegcccttgtccaagaggaggaggeggacgcgctt -62 . .
.
. .
TATA box
+1
GCGTGCGCGCTAGGTATAAATAGGTCCCAGGAGGCAGCCACTGGGCAGAA +6
gcgtgcgcattcagtataaataagtcccaagcggcggccattgggcagaa -12 .
.
+31
CTGGGCTACGGGCGCCGCGGGCCATG +33
c.gagctacaggagcctcaggccatg +14 +1
+12
B
adrenal RNA
probe
tRNA
M13 sequence TCGA
186 bp
-
(Fig. 2). No significant decrease in the transcriptional activity was noted with deletions up to position -290. There was a significant loss of activity by 2.3-fold (P < 0.005) with deletion to position -66 (which re- moved the putative SF1 site), followed by a total loss of the activity with deletion to position -16 (which removed the TATA box). These data suggested that the presence of the SF1 site may be crucial for full promoter activity. Further experiments, specifically removing the 9-bp putative SF1 site from the entire 1550-bp DAX1 promoter region, revealed a significant drop of 2.5-fold (P < 0.001) in transcriptional activity (Fig. 3). The loss of the transcriptional activity was not total, which suggested the possible regulation of transcription by other transcription factors. The abla- tion of the SF1 binding site in other promoters results in variable effects. In the LH6 gene, mutation of the SF1 site reduces the SF1 transactivation by 9.3-fold (20). Conversely, ablation of the SF1 site in the hu- man glycoprotein hormone a-subunit gene reduces the transcriptional activity by only 2-fold (31). These observations emphasize the importance of promoter context of the SF1 response element.
In order to determine the functional significance of the SF1 response element, cotransfections with the DAX1 promoter reporter gene construct and an SF1 expressing vector were performed (Fig. 3). They re- vealed that SF1 increased DAX1 promoter activity by 4-fold (P < 0.001). Cotransfection with the control vec- tor containing only the CMV promoter did not result in an increase in the galactosidase activity. The relatively low level of transactivation (4-fold) by SF1 may be explained by the presence of SF1 produced physiologi- cally by the NCI-H295 cells. Finally, the cotransfection of the SF1 expressing vector with the DAX1 promoter construct deleted for the SF1 response element showed an increase in the promoter activity of 1.3-fold, which was not significant, but was approximately 6-fold less than was observed with cotransfection of SF1 with the DAX1 promoter containing the SF1 response element. Collectively, these results demonstrate that the SF1 response element is essential for the transactivation of the DAX1 promoter by SF1.
DISCUSSION
Recently, two genes expressed during develop- ment in the hypothalamic-pituitary-adrenal/go-
the DAX1 RNA probe hybridized with 10 µg of human adult adre- nal and yeast tRNA. The protected fragment was 186 bp long. Lanes T, C, G, and A, sequence of M13 with primer -40. This sequence was used as a ladder to determine precisely the DAX1 initiation start site.
SF1 RE
TATA box
-1550
+30
H
-1129
1
-944
1
-593
1
-290
1
-66
4
-16
4
CONTROL
H
0
100
200
300
RLU ß galactosidase / RLU luciferase X 1000
nadal axis, DAX1 and SF1, were shown to be re- quired for the normal formation of adrenal cortex. In this paper, we characterize the promoter of DAX1 and identify the sequences required for expression in an adrenal cortical carcinoma cell line with features similar to those of the fetal adrenal cortex (28). Stud- ies have shown that the expression pattern of DAX1 is very similar to that of SF1 (11,24,25), with a slightly earlier detection of SF1 in the adrenal pri- mordium, and that the phenotype of the knock-out mouse for SF1 is more severe than that of patients with DAX1 mutations (26). These observations led to the hypothesis that DAX1 may be regulated by SF1 or may act with SF1 as a coregulator for normal development of the adrenal gland, and, more gener- ally, of the hypothalamic-pituitary-adrenal/go- nadal axis.
We have shown previously that SF1 binds specifi- cally to a putative SF1 response element in the DAX1 promoter (22). Our present results identify the initiation start site of DAX1 and show that 1550 bp of the promoter is sufficient to drive transcription. Our results clearly demonstrate that SF1 is func- tionally important in DAX1 gene expression in an
adrenocortical carcinoma cell line that has been demonstrated to express many of the features of the fetal adrenal cortex (28). These observations are par- ticularly relevant to AHC, since this is a disorder of the fetal cortex (5,6).
We have also shown that the deletion of the SF1- RE in the DAX1 promoter results in a drop in the transcriptional activity of 2.5-fold, which is signifi- cant since only 9 bp were deleted from the full- length promoter construct of 1550 bp. However, we cannot exclude the possibility that this 9-bp deletion affects the binding of other factors to this region. Our cotransfection experiments showed that the ac- tivity of the wild-type DAX1 promoter was enhanced
4-fold by SF1, whereas no enhancement was ob- served with the DAX1 promoter deleted for the SF1 response element. Together with the electrophoretic mobility shift assay results published previously (22), these current results indicate the functional relevance of the SF1 site in the DAX1 promoter in adrenocortical cells.
The recent characterization of the mouse DAX1 gene revealed the presence of a putative SF1 re- sponse element within the promoter (30). The se-
SF1 RE
TATA box
-1550
+30
-1550
+30
-1550
+30
pCMV +
-1550
+30
pCMV-SF1 +
-1550
+30
pCMV-SF1 +
0
200
400
600
800
1000
1200
RLU ß galactosidase / RLU luciferase X 1000
quence of this element (TCGAGGTCA in the mouse; CCGAGGTCA in humans), as well as its localization (-135 bp to -143 bp in humans; - 136 bp to -144 bp in the mouse), was conserved. The SF1 response element is localized in a highly conserved 58-bp re- gion of the human DAX1 promoter. The relatively high sequence conservation within this 58-bp region is compatible not only with the involvement of the SF1-RE in the regulation of DAX1 by SF1, but also with the possible involvement of adjacent sequences and presumed modulation by other factors.
A protein in nuclear extracts from murine Y1 adre- nal cortical cells interacts specifically with the mu- rine SF1-RE, an observation consistent with involve- ment of the SF1-RE in adrenal cortical expression of DAX1 (25) and with our results. However, in con- trast with our expression studies in the human adre- nal cortical carcinoma cell line, NCI-H295, Ikeda et al. found that the putative SF1-RE was not required for regulation of DAX1 promoter activity in mouse adrenocortical cells or MA-10 Leydig cells (25). The results of Yu et al. (32), showing upregulation of mu- rine DAX1 promoter activity by SF1 expression in human JEG-3 choriocarcinoma cells, agree with our observations, but not with those of Ikeda et al. (25).
These differences observed by various groups of investigators have several possible explanations. Positive results indicating enhancement of DAX1 ex-
pression by SF1 coexpression and the dependence of this effect on the SF1-RE were obtained in human cells, whereas negative results were obtained in mu- rine cells. Although the human and murine putative SF1-REs are conserved, there may be variations in the regulatory pathways for DAX1 gene expression in these two organisms. Similarly, differences may be observed between different tissues, in different cells within a tissue, or at different stages of develop- ment. The adrenocortical cell line, Y1, used by Ikeda et al. (25) does not express DAX1, and the cell line that they studied which does express DAX1, MA-10, is derived from testicular Leydig cells. The cells used in our investigations, NCI-H295, are a particularly good model for expression studies, since not only do they express SF1 and DAX1, but they have many of the features of the fetal adrenal cortical cells (28) that clearly exhibit pathology in AHC (5). If, for ex- ample, SF1 requires a heterodimerization partner for its effective interaction with the SF1-RE in the DAX1 promoter, as do many of the nuclear hormone receptors, then this partner may not be present in all cells, and cells in which it is absent will not respond. DAX1 expression may be influenced by a variety of factors, SF1 being only one of these.
Another argument that might be made against the involvement of SF1 in DAX1 promoter activity is the persistence of DAX1 expression in the gonad and
hypothalamus of mice lacking SF1 by disruption of Ftz-F1 (25). The adrenal primordium was not inves- tigated, but, even if DAX1 were observed in these cells in vivo, DAX1 enhancement could be influenced by the other factors in the absence of SF1. Since the cells expressing DAX1 in the hypothalamus, adrenal gland, and gonad are eventually lost in the Ftz-F1- disrupted mice, it is impossible to know whether DAX1 expression in the absence of SF1 would be normal. A critical level of DAX may be crucial for normal development of the adrenal gland, as well as the hypothalamus and pituitary, but DAX1 was not quantitated in the FTZ-F1 knockout mice (25) and might be below the required concentration for nor- mal function.
Many members of the nuclear hormone receptor superfamily bind to a direct or an inverted repetitive pair of half-sites. Therefore, these proteins usually undergo dimerization during the process of binding. However, several orphan receptors, including SF1, are capable of binding a single extended half-site, AGGTCA (33). Our study is consistent with the bind- ing of SF1 to a unique site, but does not address the question of a potential dimerization of SF1. The demonstration of the association between the or- phan nuclear receptor NGFI-B and the 9-cis-retinoic acid receptor suggests that the presence of a single response element does not exclude dimerization of the orphan receptor (34). It was recently hypothe- sized that DAX1 itself could bind to SF1, via a direct protein-protein interaction (23). If this is confirmed, the binding of DAX1 to a transcription factor (SF1) that enhances its own transcription may be part of the process of autoregulation.
It was recently shown that in testis, not all inter- stitial cells expressing DAX1 contained SF1 and many interstitial cells expressing SF1 did not ex- press DAX1 (35). Co-localization of SF1 and DAX1, however, was observed in some interstitial cells. The regulation of DAX1 expression in testis may be more complex than in adrenals and may have a fundamental role in gonadal differentiation. When a 160-kb region of Xp21, containing the DAX1 gene, is duplicated, the patients have normal adrenal function, but dosage-sensitive sex reversal: XY male genotypes with ambiguous or female genital pheno- types (7,8). The mothers of these patients, who have tandem duplications of the DSS region on one of their X chromosomes, have normal fertility and ad- renal function. Since DAX1 is a putative transcrip- tion factor, it is clearly a DSS candidate gene (1,36). The role of DAX1 in the normal development of fetal gonadal cells may be completely different than in
fetal adrenal cortex and will require further investi- gation.
ACKNOWLEDGMENTS
This work was supported by a grant from NICHD (RO1 HD- 22563) and by Howard Hughes Medical School Research Re- sources. Eric Vilain is supported by INSERM. Dr. McCabe is an Academic Associate for the Corning-Nichols Laboratories. The authors gratefully acknowledge Kathleen Sakamoto, M.D., Uni- versity of California, Los Angeles, Department of Pediatrics, for her expert advice regarding tissue culture procedure.
REFERENCES
1. Zanaria E, Muscatelli F, Bardoni B, Strom TM, Guioli S, Guo W, Lalli E, Moser C, Walker AP, McCabe ERB, Meitinger T, Monaco AP, Sassone-Corsi P, Camerino G. An unusual member of the nuclear hormone receptor superfamily re- sponsible for X-linked adrenal hypoplasia congenita. Nature 372:635-641, 1994.
2. Muscatelli F, Strom TM, Walker AP, Zanaria E, Recan D, Meindl A, Bardoni B, Guioli S, Zehetner G, Rabel W, Schwarz HP, Kaplan JC, Camerino G, Meitinger T, Monaco AP. Mutations in the Dax-1 gene give rise to both X-linked adrenal hypoplasia congenita and hypogonadotropic hypogo- nadism. Nature 372:672-676, 1994.
3. . Guo W, Mason JS, Stone CG Jr, Morgan SA, Madu SI, Bal- dini A, Lindsay EA, Biesecker LG, Copeland KC, Horlick MN, Pettigrew AL, Zanaria E, McCabe ERB. Diagnosis of X-linked adrenal hypoplasia congenita by mutation analysis of the DAX1 gene. J Am Med Assoc 274:324-330, 1995.
4. Habiby RL, Boepple P, Nachtigall L, Sluss PM, Crowley WF, Jameson JL. Adrenal hypoplasia congenita with hypogonad- otropic hypogonadism: Evidence that DAX-1 mutations lead to combined hypothalamic and pituitary defects in gonado- tropin production. J Clin Invest 98:1055-1062, 1996.
5. Seltzer WK, Firminger H, Klein J, Pike A, Fennessey P, McCabe ERB. Adrenal dysfunction in glycerol kinase defi- ciency. Biochem Med 33:189-199, 1985.
6. Marsden HB, Zakhour HD. Cytomegalic adrenal hypoplasia with pituitary cytomegaly. Virchows Arch Abt A Pathol Anat Histol 378:105-110, 1978.
7. Arn P, Chen H, Tuck-Muller CM, Mankinen C, Wachtel G, Li S, Shen C-C, Wachtel SS. SRVX, a sex reversing locus in Xp21.2 to p22.11. Hum Genet 93:389-393, 1994.
8. Bardoni B, Zanaria E, Guioli S, Floridia G, Worley K, Tonini G, Ferrante E, Chiumello G, McCabe ERB, Fraccaro M, Zuf- fardi O, Camerino G. A dosage sensitive locus at chromosome Xp21 is involved in male to female sex reversal. Nature Genet 7:497-501, 1994.
9. Seol W, Choi HS, Moore DD. An orphan nuclear hormone receptor that lacks a DNA binding domain and heterodimer- izes with other receptors. Science 272:1336-1339, 1996.
10. Guo W, Burris TP, McCabe ERB. Expression of DAX-1, the gene responsible for X-linked adrenal hypoplasia congenita and hypogonadotropic hypogonadism, in the hypothalamic- pituitary-adrenal/gonadal axis. Biochem Mol Med 56:8-13, 1995.
11. Swain A, Zanaria E, Hacker A, Lovell-Badge R, Camerino
G. Mouse Dax1 expression is consistent with a role in sex determination as well as in adrenal and hypothalamus func- tion. Nature Genet 12:404-409, 1996.
12. Ingraham HA, Lala DS, Ikeda Y, Luo X, Shen WH, Nachtigal MW, Abbud R, Nilson JH, Parker KL. The nuclear receptor steroidogenic factor 1 acts at multiple levels of the reproduc- tive axis. Genes Dev 8:2302-2312, 1994.
13. Taketo M, Parker KL, Howard TA, Tsukiyama T, Wong M, Niwa O, Morton CC, Miron PM, Seldin MF. Homologs of Drosophila Fushi-Tarazu factor 1 map to mouse chromo- some 2 and human chromosome 9q33. Genomics 25:565- 567, 1995.
14. Ikeda Y, Lala DS, Luo X, Kim E, Moisan MP, Parker KL. Characterization of the mouse FTZ-F1 gene, which encodes a key regulator of steroid hydroxylase gene expression. Mol Encocrinol 7:852-860, 1993.
15. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schütz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM. The RXR heterodimers and orphan receptors. Cell 83:835-839, 1995.
16. Lynch JP, Lala DS, Peluso JJ, Luo W, Parker KL, White BA. Steroidogenic factor 1, an orphan nuclear receptor, regu- lates the expression of the rat aromatase gene in gonadal tissues. Mol Endocrinol 7:776-786, 1993.
17. Shen WH, Moore CC, Ikeda Y, Parker KL, Ingraham HA. Nuclear receptor steroidogenic factor 1 regulates the Mülle- rian inhibiting substance gene: A link to the sex determina- tion cascade. Cell 7:651-661, 1994.
18. Rice DA, Mouw AR, Bogerd AM, Parker KL. A shared pro- moter element regulates the expression of three steroido- genic enzymes. Mol Endocrinol 5:1552-1561, 1991.
19. Barnhart KM, Mellon PL. The orphan nuclear receptor, ste- roidogenic factor-1, regulates the glycoprotein hormone alpha-subunit gene in pituitary gonadotropes. Mol Endocri- nol 8:878-885, 1994.
20. Halvorson LM, Kaiser UB, Chin WW. Stimulation of lutein- izing hormone beta gene promoter activity by the orphan nuclear receptor, steroidogenic factor-1. J Biol Chem 271:6645-6650, 1996.
21. Keri RA, Nilson JH. A steroidogenic factor-1 binding site is required for activity of the luteinizing hormone beta subunit promoter in gonadotropes of transgenic mice. J Biol Chem 271:10782-10785, 1996.
22. Burris TP, Guo W, Le T, McCabe ERB. Identification of a putative steroidogenic factor-1 response element in the DAX-1 promoter. Biochem Biophys Res Commun 214:576- 581, 1995.
23. Parker KL, Schimmer BP. The roles of the nuclear hormone
receptor steroidogenic factor 1 in endocrine differentiation and development. Trends Endocrinol Metab 7:203-207, 1996.
24. Ikeda Y, Shen W-H, Ingraham HA, Parker KL. Develop- mental expression of mouse steroidogenic factor-1, an essen- tial regulator of the steroid hydroxylases. Mol Endocrinol 8:654-662, 1994.
25. Ikeda Y, Swain A, Weber TJ, Hentges KE, Zanaria E, Lalli E, Tamai KT, Sassone-Corsi P, Lovell-Badge R, Camerino G, Parker KL. Steroidogenic factor 1 and Dax-1 colocalize in multiple cell lineages: Potential links in endocrine devel- opment. Mol Endocrinol 10:1261-1272, 1996.
26. Luo X, Ikeda Y, Parker KL. A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77:481-490, 1994.
27. Frohman MA. In PCR Protocols: A Guide to Methods and Applications (Innis MA, Gelfand DH, Sninsky JJ, White TJ, Eds.). San Diego: Academic Press, 1990, pp 28-38.
28. Staels B, Hum DW, Miller WL. Regulation of steroidogenesis in NCI-H295 cells: A cellular model of the human fetal adre- nal. Mol Endocrinol 7:423-433, 1993.
29. De Wet JR, Wood KV, DeLuca M, Helinski DR, Subramani S. Firefly luciferase gene: Structure and expression in mam- malian cells. Mol Cell Biol 7:725-737, 1987.
30. Bae DS, Schaefer ML, Partan BW, Muglia L. Characteriza- tion of the mouse DAX1 gene reveals evolutionary conserva- tion of a unique amino-terminal motif and widespread ex- pression in mouse tissue. Endocrinology 137:3921-3927, 1996.
31. Heckert LL, Schultz K, Nilson JH. Different composite regu- latory elements direct expression of the human alpha sub- unit gene to pituitary and placenta. J Biol Chem 270:26497- 26504, 1995.
32. Yu RN, Ito M, Jameson JL. Transcriptional regulation of the mouse DAX1 promoter by steroidogenic factor 1. In Pro- gram of the 10th International Congress of Endocrinology, San Francisco, 1996, P3-173. [Abstract]
33. Wilson TE, Fahrner TJ, Milbrandt J. The orphan receptors NGFI-B and steroidogenic factor 1 establish monomer bind- ing as a third paradigm of nuclear receptor-DNA interaction. Mol Cell Biol 13:5794-5804, 1993.
34. Forman BM, Umesono K, Chen J, Evans RM. Unique re- sponse pathways are established by allosteric interactions among nuclear hormone receptors. Cell 81:541-550, 1995.
35. Majdic G, Sanders PTK. Differential patterns of expression of DAX-1 and steroidogenic factor-1 (SF-1) in the fetal rat testis. Endocrinology 137:3586-3589, 1996.
36. McCabe ERB. Sex and the single DAX1: Too little is bad, but can we have too much? J Clin Invest 98:881-882, 1996.